AlanFung:LabNotes/EZ/2009-3-24: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Alan6017518
 
>Alan6017518
No edit summary
Line 1: Line 1:
='''2nd PCR run on GM20431 100 & 10 cells -  on remaining eluted DNA'''=
==Objective==
*Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells.
*Increase the amount of template DNA to be used for PCR reaction
==Samples & Materials==
*GM20431 cells
*EZ DNA Methylation Direct Kit 03/11/09
*Primers - From IDT
  --------------------------------------------------
  0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG
  0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA
  0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT
  0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA
  0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT
  0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA
  --------------------------------------------------
*Creating 100uM primer
0.1_F_chr22        27.9nmol
RNAse free H2O      279uL
0.1_R_chr22        31.8nmol
RNAse free H2O      318uL
0.8_F_chr21        31.30nmol
RNAse free H2O      313uL
0.8_R_chr21        31.70nmol
RNAse free H2O      317uL
0.9_F_chr8          30.10nmol
RNAse free H2O      301uL
0.9_R_chr8          29.30nmol
RNAse free H2O      293uL
------------------------------
*Making 3.3uM primer working solution
Dilute 33uL 100uM primer with 967uL RNAse free H2O
*Jurkat gDNA (100ug/mL)
*Dilute 1uL stock gDNA with 99uL RNAse-free H20
*Agarose Gel
==Overview==
*PCR amplification
*Agarose Gel Electrophoresis
==Procedures==
*PCR
  Sample A 100 cell GM20431
                      A        B        C
  -------------------------------------------------
                      CHR22    CHR21    CHR8
  2X iQ Super Mix    20        20        20
  Primer F (3.3uM)    6        6        6 
  Primer R (3.3uM)    6        6        6   
  gDNA                2.8      2.8      2.8 
  RNAse free H20      5.2      5.2      5.2 
  -------------------------------------------------
  Total                                  40uL
  Sample B 10 cell GM20431
                      A        B        C
  -------------------------------------------------
                      CHR22    CHR21    CHR8
  2X iQ Super Mix    20        20        20
  Primer F (3.3uM)    6        6        6 
  Primer R (3.3uM)    6        6        6   
  gDNA                2.8      2.8      2.8 
  RNAse free H20      5.2      5.2      5.2 
  -------------------------------------------------
  Total                                  40uL
 
A-CHR22 F/R
B-CHR21 F/R
C-CHR8  F/R
Perform PCR reaction in thermocycler
 
      Step1  96C, 3m
      Step2  95C, 30s
      Step3  62C, 1m
      Step4  72C, 1m
      Step5  Go to step2 repeat 39 times
      Step6  72C, 5m
      Step7  4C,  Forever
*Gel Electrophoresis
                                  Gel 1
Well            1    2    3    4    5    6    7      8
-----------------------------------------------------------------
Content          Blank AA    AB    AC    BA  BB    BC    Ladder
Sample          0    10    10    10    10  10    10    3
6X Loading Dye  0    2    2    2    2    2    2      3
-----------------------------------------------------------------
Total                                              14uL  9uL
*Run gel at 135 V for 20 min.
[[Image:ZhangLab_2 2009-03-25 09hr 42min_crop.jpg]]
[[Image:ZhangLab_2 2009-03-25 09hr 42min_crop.jpg]]

Revision as of 22:25, 25 March 2009

2nd PCR run on GM20431 100 & 10 cells - on remaining eluted DNA

Objective

  • Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells.
  • Increase the amount of template DNA to be used for PCR reaction


Samples & Materials

  • GM20431 cells
  • EZ DNA Methylation Direct Kit 03/11/09
  • Primers - From IDT
  --------------------------------------------------
  0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG
  0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA
  0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT
  0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA
  0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT
  0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA
  --------------------------------------------------
  • Creating 100uM primer
0.1_F_chr22         27.9nmol 
RNAse free H2O      279uL
0.1_R_chr22         31.8nmol
RNAse free H2O      318uL
0.8_F_chr21         31.30nmol
RNAse free H2O      313uL
0.8_R_chr21         31.70nmol
RNAse free H2O      317uL
0.9_F_chr8          30.10nmol
RNAse free H2O      301uL
0.9_R_chr8          29.30nmol
RNAse free H2O      293uL

  • Making 3.3uM primer working solution

Dilute 33uL 100uM primer with 967uL RNAse free H2O

  • Jurkat gDNA (100ug/mL)
  • Dilute 1uL stock gDNA with 99uL RNAse-free H20
  • Agarose Gel

Overview

  • PCR amplification
  • Agarose Gel Electrophoresis

Procedures

  • PCR


 Sample A 100 cell GM20431
                     A         B         C
 -------------------------------------------------
                     CHR22     CHR21     CHR8
 2X iQ Super Mix     20        20        20
 Primer F (3.3uM)    6         6         6  
 Primer R (3.3uM)    6         6         6     
 gDNA                2.8       2.8       2.8   
 RNAse free H20      5.2       5.2       5.2  
 -------------------------------------------------
 Total                                   40uL


 Sample B 10 cell GM20431
                     A         B         C
 -------------------------------------------------
                     CHR22     CHR21     CHR8
 2X iQ Super Mix     20        20        20
 Primer F (3.3uM)    6         6         6  
 Primer R (3.3uM)    6         6         6     
 gDNA                2.8       2.8       2.8   
 RNAse free H20      5.2       5.2       5.2  
 -------------------------------------------------
 Total                                   40uL


A-CHR22 F/R
B-CHR21 F/R
C-CHR8  F/R


Perform PCR reaction in thermocycler

      Step1   96C, 3m
      Step2   95C, 30s
      Step3   62C, 1m
      Step4   72C, 1m
      Step5   Go to step2 repeat 39 times
      Step6   72C, 5m
      Step7   4C,  Forever
  • Gel Electrophoresis
                                 Gel 1
Well             1     2     3     4     5    6     7      8
-----------------------------------------------------------------
Content          Blank AA    AB    AC    BA   BB    BC     Ladder
Sample           0     10    10    10    10   10    10     3
6X Loading Dye   0     2     2     2     2    2     2      3
-----------------------------------------------------------------
Total                                               14uL   9uL



  • Run gel at 135 V for 20 min.


File:ZhangLab 2 2009-03-25 09hr 42min crop.jpg