AlanFung:LabNotes/EZ/2009-3-24: Difference between revisions
Jump to navigation
Jump to search
>Alan6017518 (New page: Image:ZhangLab_2 2009-03-25 09hr 42min_crop.jpg) |
>Alan6017518 No edit summary |
||
Line 1: | Line 1: | ||
='''2nd PCR run on GM20431 100 & 10 cells - on remaining eluted DNA'''= | |||
==Objective== | |||
*Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells. | |||
*Increase the amount of template DNA to be used for PCR reaction | |||
==Samples & Materials== | |||
*GM20431 cells | |||
*EZ DNA Methylation Direct Kit 03/11/09 | |||
*Primers - From IDT | |||
-------------------------------------------------- | |||
0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG | |||
0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA | |||
0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT | |||
0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA | |||
0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT | |||
0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA | |||
-------------------------------------------------- | |||
*Creating 100uM primer | |||
0.1_F_chr22 27.9nmol | |||
RNAse free H2O 279uL | |||
0.1_R_chr22 31.8nmol | |||
RNAse free H2O 318uL | |||
0.8_F_chr21 31.30nmol | |||
RNAse free H2O 313uL | |||
0.8_R_chr21 31.70nmol | |||
RNAse free H2O 317uL | |||
0.9_F_chr8 30.10nmol | |||
RNAse free H2O 301uL | |||
0.9_R_chr8 29.30nmol | |||
RNAse free H2O 293uL | |||
------------------------------ | |||
*Making 3.3uM primer working solution | |||
Dilute 33uL 100uM primer with 967uL RNAse free H2O | |||
*Jurkat gDNA (100ug/mL) | |||
*Dilute 1uL stock gDNA with 99uL RNAse-free H20 | |||
*Agarose Gel | |||
==Overview== | |||
*PCR amplification | |||
*Agarose Gel Electrophoresis | |||
==Procedures== | |||
*PCR | |||
Sample A 100 cell GM20431 | |||
A B C | |||
------------------------------------------------- | |||
CHR22 CHR21 CHR8 | |||
2X iQ Super Mix 20 20 20 | |||
Primer F (3.3uM) 6 6 6 | |||
Primer R (3.3uM) 6 6 6 | |||
gDNA 2.8 2.8 2.8 | |||
RNAse free H20 5.2 5.2 5.2 | |||
------------------------------------------------- | |||
Total 40uL | |||
Sample B 10 cell GM20431 | |||
A B C | |||
------------------------------------------------- | |||
CHR22 CHR21 CHR8 | |||
2X iQ Super Mix 20 20 20 | |||
Primer F (3.3uM) 6 6 6 | |||
Primer R (3.3uM) 6 6 6 | |||
gDNA 2.8 2.8 2.8 | |||
RNAse free H20 5.2 5.2 5.2 | |||
------------------------------------------------- | |||
Total 40uL | |||
A-CHR22 F/R | |||
B-CHR21 F/R | |||
C-CHR8 F/R | |||
Perform PCR reaction in thermocycler | |||
Step1 96C, 3m | |||
Step2 95C, 30s | |||
Step3 62C, 1m | |||
Step4 72C, 1m | |||
Step5 Go to step2 repeat 39 times | |||
Step6 72C, 5m | |||
Step7 4C, Forever | |||
*Gel Electrophoresis | |||
Gel 1 | |||
Well 1 2 3 4 5 6 7 8 | |||
----------------------------------------------------------------- | |||
Content Blank AA AB AC BA BB BC Ladder | |||
Sample 0 10 10 10 10 10 10 3 | |||
6X Loading Dye 0 2 2 2 2 2 2 3 | |||
----------------------------------------------------------------- | |||
Total 14uL 9uL | |||
*Run gel at 135 V for 20 min. | |||
[[Image:ZhangLab_2 2009-03-25 09hr 42min_crop.jpg]] | [[Image:ZhangLab_2 2009-03-25 09hr 42min_crop.jpg]] |
Revision as of 22:25, 25 March 2009
2nd PCR run on GM20431 100 & 10 cells - on remaining eluted DNA
Objective
- Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells.
- Increase the amount of template DNA to be used for PCR reaction
Samples & Materials
- GM20431 cells
- EZ DNA Methylation Direct Kit 03/11/09
- Primers - From IDT
-------------------------------------------------- 0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG 0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA 0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT 0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA 0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT 0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA --------------------------------------------------
- Creating 100uM primer
0.1_F_chr22 27.9nmol RNAse free H2O 279uL
0.1_R_chr22 31.8nmol RNAse free H2O 318uL
0.8_F_chr21 31.30nmol RNAse free H2O 313uL
0.8_R_chr21 31.70nmol RNAse free H2O 317uL
0.9_F_chr8 30.10nmol RNAse free H2O 301uL
0.9_R_chr8 29.30nmol RNAse free H2O 293uL
- Making 3.3uM primer working solution
Dilute 33uL 100uM primer with 967uL RNAse free H2O
- Jurkat gDNA (100ug/mL)
- Dilute 1uL stock gDNA with 99uL RNAse-free H20
- Agarose Gel
Overview
- PCR amplification
- Agarose Gel Electrophoresis
Procedures
- PCR
Sample A 100 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 2.8 2.8 2.8 RNAse free H20 5.2 5.2 5.2 ------------------------------------------------- Total 40uL
Sample B 10 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 2.8 2.8 2.8 RNAse free H20 5.2 5.2 5.2 ------------------------------------------------- Total 40uL
A-CHR22 F/R
B-CHR21 F/R
C-CHR8 F/R
Perform PCR reaction in thermocycler
Step1 96C, 3m Step2 95C, 30s Step3 62C, 1m Step4 72C, 1m Step5 Go to step2 repeat 39 times Step6 72C, 5m Step7 4C, Forever
- Gel Electrophoresis
Gel 1 Well 1 2 3 4 5 6 7 8 ----------------------------------------------------------------- Content Blank AA AB AC BA BB BC Ladder Sample 0 10 10 10 10 10 10 3 6X Loading Dye 0 2 2 2 2 2 2 3 ----------------------------------------------------------------- Total 14uL 9uL
- Run gel at 135 V for 20 min.