AlanFung:LabNotes/EZ/2009-3-24: Difference between revisions
Jump to navigation
Jump to search
>Alan6017518 No edit summary |
>Alan6017518 |
||
Line 117: | Line 117: | ||
*Run gel at 135 V for 20 min. | *Run gel at 135 V for 20 min. | ||
==Result== | |||
[[Image:ZhangLab_2 2009-03-25 09hr 42min_crop.jpg]] | |||
*All 3 pairs of primers showed up on the 100 cells methylation | |||
*No bands at all for the 10 cells methylation | |||
==Sugestion== | |||
*Repeat 10 cells methylation | |||
*Elute DNA with 8uL elution buffer | |||
*Use all 8uL dna as template for one pair of primer | |||
*Reduce washing step from two times to one | |||
*For one set (3x10cells- one washing before elution) | |||
*For the other set (2x10cells-two washing before elution |
Latest revision as of 22:29, 25 March 2009
2nd PCR run on GM20431 100 & 10 cells - on remaining eluted DNA[edit]
Objective[edit]
- Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells.
- Increase the amount of template DNA to be used for PCR reaction
Samples & Materials[edit]
- GM20431 cells
- EZ DNA Methylation Direct Kit 03/11/09
- Primers - From IDT
-------------------------------------------------- 0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG 0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA 0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT 0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA 0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT 0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA --------------------------------------------------
- Creating 100uM primer
0.1_F_chr22 27.9nmol RNAse free H2O 279uL
0.1_R_chr22 31.8nmol RNAse free H2O 318uL
0.8_F_chr21 31.30nmol RNAse free H2O 313uL
0.8_R_chr21 31.70nmol RNAse free H2O 317uL
0.9_F_chr8 30.10nmol RNAse free H2O 301uL
0.9_R_chr8 29.30nmol RNAse free H2O 293uL
- Making 3.3uM primer working solution
Dilute 33uL 100uM primer with 967uL RNAse free H2O
- Jurkat gDNA (100ug/mL)
- Dilute 1uL stock gDNA with 99uL RNAse-free H20
- Agarose Gel
Overview[edit]
- PCR amplification
- Agarose Gel Electrophoresis
Procedures[edit]
- PCR
Sample A 100 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 2.8 2.8 2.8 RNAse free H20 5.2 5.2 5.2 ------------------------------------------------- Total 40uL
Sample B 10 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 2.8 2.8 2.8 RNAse free H20 5.2 5.2 5.2 ------------------------------------------------- Total 40uL
A-CHR22 F/R
B-CHR21 F/R
C-CHR8 F/R
Perform PCR reaction in thermocycler
Step1 96C, 3m Step2 95C, 30s Step3 62C, 1m Step4 72C, 1m Step5 Go to step2 repeat 39 times Step6 72C, 5m Step7 4C, Forever
- Gel Electrophoresis
Gel 1 Well 1 2 3 4 5 6 7 8 ----------------------------------------------------------------- Content Blank AA AB AC BA BB BC Ladder Sample 0 10 10 10 10 10 10 3 6X Loading Dye 0 2 2 2 2 2 2 3 ----------------------------------------------------------------- Total 14uL 9uL
- Run gel at 135 V for 20 min.
Result[edit]
File:ZhangLab 2 2009-03-25 09hr 42min crop.jpg
- All 3 pairs of primers showed up on the 100 cells methylation
- No bands at all for the 10 cells methylation
Sugestion[edit]
- Repeat 10 cells methylation
- Elute DNA with 8uL elution buffer
- Use all 8uL dna as template for one pair of primer
- Reduce washing step from two times to one
- For one set (3x10cells- one washing before elution)
- For the other set (2x10cells-two washing before elution