Daniel:Notebook/ComboLock/2016-8-16: Difference between revisions
>Djacobse |
>Djacobse |
||
(8 intermediate revisions by the same user not shown) | |||
Line 253: | Line 253: | ||
===Gel Imaging Results=== | ===Gel Imaging Results=== | ||
<gallery perrow=2 heights=300px widths=300px> | |||
File:2016-08-16-PosControlAmplicon-TBU.png|TBU Gel Image | |||
File:2016-08-16-PosControlAmplicon-TBE.png|TBE Gel Image | |||
</gallery> | |||
==Protocol (Part 3)== | |||
Since the TBE gel showed a smear at the correct range (104 bp, but with a lot of DNA and biotin attached it runs funny), I'll be moving on to a size select and purification. | |||
<ol start="7"> | |||
<li>Size select gel</li> | |||
<ol type="A"> | |||
<li>Mix 40 uL TBE, 10 uL loading dye, and 10 uL sample for C1-C2 and C3-C2</li> | |||
<li>Mix 23 uL TBE, 5 uL loading dye, and 2 uL ladder</li> | |||
<li>Add 30 uL to each lane (2 lanes for C1-C2 and C3-C2)</li> | |||
<li>Run the gel at 250V for 25 min</li> | |||
<li>Stain with 3 uL SYBR gold for 3 min</li> | |||
<li>Image, and extract bands between 100bp and 125 bp; collect the gel bands in the same tube</li> | |||
<gallery perrow=2 heights=200px widths=200px> | <gallery perrow=2 heights=200px widths=200px> | ||
File:| | File:2016-08-16-PosControlAmplicon-SizeSelect.png|Before Image | ||
File:| | File:2016-08-16-PosControlAmplicon-SizeSelect-After.png|After Image | ||
</gallery> | </gallery> | ||
<li>Shred the gel by centrifuging at 14000rpm for 1 min 30 sec</li> | |||
</ol> | |||
As you can see from the gel images, there was too much DNA on the gel and it ran funny. Besides, the caps fell off in the centrifuge. | |||
[[Category:ComboLock]] [[Category:20160805]] |
Latest revision as of 22:22, 17 August 2016
Positive Control Amplicon Production[edit]
Theory[edit]
The C1 and C3 amplicons
C1 Amplicon (PCAmp1): 5-ACGGCGGACCTCGCACGGTATTTGTACCGTGGACGGTCGCGTTCACTAAATG-3
C2 Amplicon (PCAmp2): 5-GCCCGTATCGGCGATGCGTGATCGGGGCGCCTACCCCGCCCAGTAACCGGCG/Biotin/-3
C3 Amplicon (PCAmp3): 5-ACGGCGGACCTCGCACGGCTGCCAACCCGTGGACGGTCGCGTTCGATGCGTC-3
Reaction Trimers:
Note that the | symbol denotes the break between the two amplicons and the space on the latches is just for visualization
LatchX2-Rev 3-GGCACCTGCCAGCGCAAGTGATTTAC CGGGCATAGCCGCTACGCACTAGCCC-5 PCAmp1|PCAmp2 5-ACGGCGGACCTCGCACGGTATTTGTACCGTGGACGGTCGCGTTCACTAAATG|GCCCGTATCGGCGATGCGTGATCGGGGCGCCTACCCCGCCCAGTAACCGGCG/Biotin/
LatchX3-Rev 3-GGCACCTGCCAGCGCAAGCTACGCAG CGGGCATAGCCGCTACGCACTAGCCC-5 PCAmp3|PCAmp2 5-ACGGCGGACCTCGCACGGCTGCCAACCCGTGGACGGTCGCGTTCGATGCGTC|GCCCGTATCGGCGATGCGTGATCGGGGCGCCTACCCCGCCCAGTAACCGGCG/Biotin/
Protocol[edit]
To complete the ligation reaction it is necessary that the oligo on the 3' end of the amplicon have a phosphate group on its 5' end. This requires a T4 Polynucleotide Kinase reaction (or ordering an oligo with a 5' phosphate). After the addition of the 5' phosphate I will incubate the oligos together in equal molar ratios to and add ligase to perform the ligation reaction.
- Prep
- Resuspend each amplicon to 100 uM according to table
- Phosphorylation
- In a 0.2 mL tube, add ingredients according to table
- Incubate at 37C for 30 min
- Ligation
- Set up 2 reactions with the following reagents (DO NOT ADD LIGASE YET)
- Add amplicons according to following table
- Heat reaction to 95C for 5 min
- Lower temp to 55C
- Add 1 uL Amp Ligase to each reaction without removing from thermocycler; swirl with pipette tip 5 times to mix
- Incubate at 55C for 2 hours
- Heat to 95 C to denature dsDNA
- Purify with ssDNA column
- ssDNA Column
- Add 100 uL Binding Buffer to the sample; mix well
- Transfer to IIC Column and centrifuge at 14000 rpm for 1 minute; SAVE THE FLOW THROUGH
- Add 150 uL 100% EtOH to flow through; mix well
- Transfer to IC Column and centrifuge at 14000 rpm for 1 minute; discard flow through
- Add 400 uL Prep Buffer and centrifuge at 14000 rpm for 1 minute; discard flow through
- Add 700 uL Wash Buffer and centrifuge at 14000 rpm for 1 minute; discard flow through
- Add 400 uL Wash Buffer and centrifuge at 14000 rpm for 1 minute; discard flow through
- Centrifuge empty column at 14000 rpm for 2 minutes
- Transfer to empty 1.5mL centrifuge tube (low bind)
- Add 30 uL nfH2O and centrifuge at 14000 rpm for 1 minute
- TBU gel
- Prerun gel for 15 minutes at 250V
- Mix 9 uL TBE, 10 uL 2X Buffer, 1 uL sample for 10 bp ladder, C1-C2 amplicon, and C3-C2 amplicon
- Remove urea from wells by pipetting up and down with a 200 uL pipette
- Add 20 uL to each lane
- Run gel for 25 min at 250V
- Stain with 3 uL SYBR Gold for 3 min
- Rinse and image (see gallery below)
- TBE Gel
- Mix 36 uL TBE and 8 uL 6x Gel Loading dye
- Aliquot 10 uL for each sample to parafilm
- Add 1 uL of sample/ladder to the drops
- Mix with the loading pipette and add 10 uL to each lane
- Run for 25 min at 250V
- Stain with 3 uL SYBR Gold for 3 min
- Rinse and image (see gallery below)
- 2016-08-16-PosControlAmplicon-TBU.png
TBU Gel Image
- 2016-08-16-PosControlAmplicon-TBE.png
TBE Gel Image
- Size select gel
- Mix 40 uL TBE, 10 uL loading dye, and 10 uL sample for C1-C2 and C3-C2
- Mix 23 uL TBE, 5 uL loading dye, and 2 uL ladder
- Add 30 uL to each lane (2 lanes for C1-C2 and C3-C2)
- Run the gel at 250V for 25 min
- Stain with 3 uL SYBR gold for 3 min
- Image, and extract bands between 100bp and 125 bp; collect the gel bands in the same tube
- 2016-08-16-PosControlAmplicon-SizeSelect.png
Before Image
- 2016-08-16-PosControlAmplicon-SizeSelect-After.png
After Image
- Shred the gel by centrifuging at 14000rpm for 1 min 30 sec
Sequence | uL nfH2O |
PCAmp1 | 650 |
PCAmp2 | 753 |
PCAmp3 | 699 |
LatchX2 | 631 |
LatchX3 | 737 |
Reagent | Stock Conc | Final Conc./Amount | uL added |
AmpLigase Reaction Buffer | 10X | 1X | 2 |
ATP | 10 mM | 1 mM | 2 |
PCAmp2 | 100 uM | 1 nmol total | 10 |
T4 DNA Kinase | 10 U/uL | 10 U | 1 |
nfH2O | NA | NA | 5 |
Total | 20 |
Reagent | Stock Conc | Final Conc./Amount | uL added |
AmpLigase Reaction Buffer | 10X | 1X | 4 |
Latch Oligo | 100 uM | 500 umol | 5 |
5' Amplicon Oligo | 100 uM | 500 umol | 5 |
Amp Ligase | 5 U/uL | 5 U | 1 |
Phosphate Reaction | NA | NA | 10 |
nfH2O | NA | NA | 25 |
Total | 50 |
Sample | PCAmp1 | PCAmp3 | LatchX2 | LatchX3 |
AmpliconX1 | X | X | ||
AmpliconX3 | X | X |
Nanodrop Results[edit]
Sample | ng/uL ssDNA |
C1-C2 Amplicon | 293.7 |
C3-C2 Amplicon | 326.4 |
Protocol (Part 2)[edit]
Results are inconclusive, I'm going to try a TBE gel with the 25bp ladder, which is generally easier to read than the 10bp ladder
Gel Imaging Results[edit]
Protocol (Part 3)[edit]
Since the TBE gel showed a smear at the correct range (104 bp, but with a lot of DNA and biotin attached it runs funny), I'll be moving on to a size select and purification.
As you can see from the gel images, there was too much DNA on the gel and it ran funny. Besides, the caps fell off in the centrifuge.