Matt:LabNotes/2016-9-9: Difference between revisions
Jump to navigation
Jump to search
>Mzcai (Created page with " =SplintR Ligase Test 2 = *Previous test ==Reference== *V4 and V7 Capture Experiment *[[Matt:LabNotes/2015-3-19|V4 Cap...") |
>Mzcai |
||
Line 164: | Line 164: | ||
| ISB_CA_AR.T3||CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG||Indx3 | | ISB_CA_AR.T3||CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG||Indx3 | ||
|} | |} | ||
{| {{table}} | {| {{table}} | ||
| align="center" style="background:#f0f0f0;"|'''Sample''' | | align="center" style="background:#f0f0f0;"|'''Sample''' | ||
Line 182: | Line 182: | ||
|- | |- | ||
| 6||3||ISB_CA_AF||ISB_CA_AR.T3 | | 6||3||ISB_CA_AF||ISB_CA_AR.T3 | ||
|} | |} | ||
====PCR Test for Non-Enzyme Digested Samples==== | ====PCR Test for Non-Enzyme Digested Samples==== | ||
Line 233: | Line 233: | ||
[[Media:SplintR_Ligase_Test_qPCR_-_Enzyme_Digest.xlsx|Excel sheet with full PCR data]]<br> | [[Media:SplintR_Ligase_Test_qPCR_-_Enzyme_Digest.xlsx|Excel sheet with full PCR data]]<br> | ||
[[File:SplintR_Ligase_Test_qPCR_-_Enzyme_Digest.JPG|450px]] | [[File:SplintR_Ligase_Test_qPCR_-_Enzyme_Digest.JPG|450px]] | ||
--> | |||
==Results & Conclusion== | ==Results & Conclusion== |
Revision as of 21:56, 9 September 2016
SplintR Ligase Test 2
Reference
Experimental Outline
- V8 Padlock Probe capture to RNA
- Ran out of V6 probes used last time
- V8 is a subset of V6 probes (targets constitutive exons instead of contigs of exons)
- Quantify captured products by qPCR
- Also adds Illumina sequencing adapters
Sample Groups
- Use Universal Human Reference RNA (UHRR 740000-41)
- 3 RNA template concentrations for each (30ng, 150ng and 820ng)
- For DNA template positive control only do 1 sample using 300ng gDNA 12878
- NTC - 8.19ng V8 - SplintR
- NTC - 40.9ng V8 - SplintR
- NTC - 221.1ng V8 - SplintR
- 30ng RNA - 8.19ng V8 - SplintR
- 150ng RNA - 40.9ng V8 - SplintR
- 820ng RNA - 221.1ng V8 - SplintR
- PosCtrl: 300ng DNA - 16.38ng V8 - Ampligase
- NegCtrl: 150ng RNA - 40.9ng V8 - Ampligase
- Summary:
- 3 NTC samples with varying amount of padlock probes that matches experimental sample
- 3 experimental samples of 30ng, 150ng, and 820ng UHRR
- 1 PosCtrl that uses Ampligase for V8 to capture 300ng gDNA (876:1 probe:target ratio)
- 1 NegCtrl that uses Ampligase for V8 to capture 150ng UHRR
Experiment
V8 Padlock Probe Capture
- Dilute 1.5ul of 1ug/ul UHRR into 30ul total(50ng/ul final conc)
- DNA is 12878 80.3ng/ul
- V8 padlock probes: 874nM
- Add 5.2ul to samples 3 & 6 and then dilute remaining ~4ul to 19ul final volume
Sample # | RNA (50ng/ul) | DNA (80.3ng/ul) | V8 (42.7ng/ul) | V8 (8.19ng/ul) | 10X SplintR Buffer (*=Ampligase) | H2O | Total |
1 | 0 | 0 | 0 | 1 | 3 | 26 | 30 |
2 | 0 | 0 | 0 | 5 | 3 | 22 | 30 |
3 | 0 | 0 | 5.2 | 0 | 3 | 21.8 | 30 |
4 | 0.6 | 0 | 0 | 1 | 3 | 25.4 | 30 |
5 | 3 | 0 | 0 | 5 | 3 | 19 | 30 |
6 | 16.4 | 0 | 5.2 | 0 | 3 | 5.4 | 30 |
7 | 0 | 3.8 | 0 | 2 | 3* | 21.2 | 30 |
8 | 3 | 0 | 0 | 5 | 3* | 19 | 30 |
- Added 50ul mineral oil on top
Program
- 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h
- Add 3ul Enzyme mix prepared on ice!
- Samples 7-8: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
- Samples 1-6: 12ul SplintR + 2ul 10X SplintR Buffer + 6ul H2O
- Incubate at 37C for 15min
- 94C for 2min
- Enzyme digest template 37C for 1 hr
- 2ul Exo I/III (1:1) for DNA
- 2ul RNaseH and Riboshredder (1:1) for RNA
- First add 1ul 5M NaCl (100nM NaCl or KCl for Riboshredder)
- 94C for 2min
Results & Conclusion
- Pos Ctrl (V6 probes capture gDNA with Ampligase) has low amount of ligated padlock probes
- High Ct in PCR curve
- I guess 300ng gDNA has fewer targets than 30ng RNA
- But same low level as Neg Ctrl (Ampligase used on DNA/RNA hybrid)
- NTC (V6 captures nothing with SplintR) has same amount of ligated padlock probes as Experimental samples (V6 captures RNA with SplintR)
- suggests SplintR doesn't need RNA splint to ligate DNA
- CONCLUSION: Need to check literature and/or call NEB but it seems SplintR has high ssDNA ligase activity, making it unusable for high specificity padlock probe applications
- Checked and there is no reported ssDNA ligase activity, therefore it must be probes annealing to other probes
- "Template-independent ligation"
-->