Matt:LabNotes/2016-11-15: Difference between revisions
Jump to navigation
Jump to search
>Mzcai |
>Mzcai mNo edit summary |
||
Line 1: | Line 1: | ||
=In vitro capture with CA12kOct2016 V4 | =In vitro capture with CA12kOct2016 V4= | ||
*gDNA and UHRR | *gDNA and UHRR | ||
*SplintR and T4 DNA Ligase for HBRR | *SplintR and T4 DNA Ligase for HBRR | ||
Line 89: | Line 89: | ||
***Thermo T4 DNA Ligase HC, 30 Weiss U/ul | ***Thermo T4 DNA Ligase HC, 30 Weiss U/ul | ||
***ATP 10mM | ***ATP 10mM | ||
===qPCR=== | ===qPCR=== | ||
====Primers==== | ====Primers==== | ||
Line 110: | Line 110: | ||
| align="center" style="background:#f0f0f0;"|'''Components''' | | align="center" style="background:#f0f0f0;"|'''Components''' | ||
| align="center" style="background:#f0f0f0;"|'''1X Volume''' | | align="center" style="background:#f0f0f0;"|'''1X Volume''' | ||
| align="center" style="background:#f0f0f0;"|''' | | align="center" style="background:#f0f0f0;"|'''4X Volume''' | ||
|- | |- | ||
| Captured template||1||0 | | Captured template||1||0 | ||
|- | |- | ||
| 10uM ISB_CA_AF||0.4||6 | | 10uM ISB_CA_AF||0.4||1.6 | ||
|- | |- | ||
| 10uM ISB_CA_AR.T1||0.4||6 | | 10uM ISB_CA_AR.T1||0.4||1.6 | ||
|- | |- | ||
| 2X KAPA SYBG MM||12.5|| | | 2X KAPA SYBG MM||12.5||50 | ||
|- | |- | ||
| H2O||10.7|| | | H2O||10.7||42.8 | ||
|- | |- | ||
| Total||25|| | | Total||25||96 | ||
|} | |} | ||
*Aliquot 24ul from | *Aliquot 24ul from 4X master mix and add 1ul captured template | ||
Program | Program | ||
98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min | 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min | ||
<!-- | |||
==Results== | ==Results== | ||
===Before Exo I/III Digest of Unligated Padlock Probes=== | ===Before Exo I/III Digest of Unligated Padlock Probes=== |
Revision as of 22:11, 18 November 2016
In vitro capture with CA12kOct2016 V4
- gDNA and UHRR
- SplintR and T4 DNA Ligase for HBRR
Reference
Experimental Outline
- CA12kOct2016 V4 Padlock Probe capture of gDNA and RNA
- Sequence to quantify probe efficiencies
Sample Groups
- RNA template = 100ng Universal Human Reference RNA (UHRR 740000-41)
- DNA template = 300ng gDNA 12878
- NTC - 9.9ng V4 - SplintR
- 150ng RNA - 9.9ng V4 - SplintR
- 150ng RNA - 9.9ng V4 - T4
- 160ng gDNA - 9.9ng V4 - Ampligase
Experiment
V4 Padlock Probe Capture
- Dilute 1.5ul of 1ug/ul UHRR into 30ul total(50ng/ul final conc)
- DNA is 12878 80.3ng/ul
- V4 padlock probes: *20.7nM
Sample | RNA (50ng/ul) | DNA (80.3ng/ul) | V4 | 10X Buffer | H2O | Total |
NTC | 0 | 0 | 10 | 3 | 17 | 30 |
SplintR | 3 | 0 | 10 | 3 | 14 | 30 |
T4 | 3 | 0 | 10 | 3 | 14 | 30 |
Ampligase | 0 | 2 | 10 | 3 | 15 | 30 |
- Added 50ul mineral oil on top
Program
- 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h
- -> add 3ul Enzyme mix
- For Ampligase: -> 55C 20h -> 94C 2min -> add 2ul Exo I/III -> 37C 2h -> 94C 2min -> 4C hold
- For SplintR and T4: -> 37C 15min -> 94C 2min -> add 2ul Exo I/III -> 37C 2h -> 94C 2min -> 4C hold
- Add 3ul Enzyme mix prepared on ice!
- Ampligase: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
- NTC & SplintR: 12ul SplintR + 2ul 10X SplintR Buffer + 6ul H2O
- T4: 1ul T4 DNA Ligase + 1ul 10X T4 Buffer + 5.5ul ATP + 2.5ul H2O
- Thermo T4 DNA Ligase HC, 30 Weiss U/ul
- ATP 10mM
qPCR
Primers
Primer | Sequence | Index # |
ISB_CA_AF | AATGATACGGCGACCACCGAGATCTACACGCCTGCATATCGGGAAGCTGAAG | |
ISB_CA_AR.T1 | CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTGCCTTCCCGATATCCGACGG | Indx1 |
ISB_CA_AR.T2 | CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTGCCTTCCCGATATCCGACGG | Indx2 |
ISB_CA_AR.T3 | CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG | Indx3 |
PCR Test for Non-Enzyme Digested Samples
Components | 1X Volume | 4X Volume |
Captured template | 1 | 0 |
10uM ISB_CA_AF | 0.4 | 1.6 |
10uM ISB_CA_AR.T1 | 0.4 | 1.6 |
2X KAPA SYBG MM | 12.5 | 50 |
H2O | 10.7 | 42.8 |
Total | 25 | 96 |
- Aliquot 24ul from 4X master mix and add 1ul captured template
Program 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min