Matt:LabNotes/2016-11-15: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
mNo edit summary
>Mzcai
Line 154: Line 154:
   Program
   Program
   98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min
   98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min
[[File:20161203_invitro_CA12kOct2016V4_PCR.png|450px]]

Revision as of 20:04, 4 December 2016

In vitro capture with CA12kOct2016 V4

  • gDNA and UHRR
  • SplintR and T4 DNA Ligase for HBRR

Reference

Experimental Outline

  1. CA12kOct2016 V4 Padlock Probe capture of gDNA and RNA
  2. Sequence to quantify probe efficiencies

Sample Groups

  • RNA template = 100ng Universal Human Reference RNA (UHRR 740000-41)
  • DNA template = 300ng gDNA 12878
  1. NTC - 9.9ng V4 - SplintR
  2. 150ng RNA - 9.9ng V4 - SplintR
  3. 150ng RNA - 9.9ng V4 - T4
  4. 160ng gDNA - 9.9ng V4 - Ampligase

Experiment

V4 Padlock Probe Capture

  • Dilute 1.5ul of 1ug/ul UHRR into 30ul total(50ng/ul final conc)
  • DNA is 12878 80.3ng/ul
  • V4 padlock probes: *20.7nM
Sample RNA (50ng/ul) DNA (80.3ng/ul) V4 10X Buffer H2O Total
NTC 0 0 10 3 17 30
SplintR 3 0 10 3 14 30
T4 3 0 10 3 14 30
Ampligase 0 2 10 3 15 30
  • Added 50ul mineral oil on top

Program

  • 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h
  • -> add 3ul Enzyme mix
  • For Ampligase: -> 55C 20h -> 94C 2min -> add 2ul Exo I/III -> 37C 2h -> 94C 2min -> 4C hold
  • For SplintR and T4: -> 37C 15min -> 94C 2min -> add 2ul Exo I/III -> 37C 2h -> 94C 2min -> 4C hold
  • Add 3ul Enzyme mix prepared on ice!
    • Ampligase: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
    • NTC & SplintR: 12ul SplintR + 2ul 10X SplintR Buffer + 6ul H2O
    • T4: 1ul T4 DNA Ligase + 1ul 10X T4 Buffer + 5.5ul ATP + 2.5ul H2O
      • Thermo T4 DNA Ligase HC, 30 Weiss U/ul
      • ATP 10mM

qPCR

Primers

Primer Sequence Index #
ISB_CA_AF AATGATACGGCGACCACCGAGATCTACACGCCTGCATATCGGGAAGCTGAAG
ISB_CA_AR.T1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTGCCTTCCCGATATCCGACGG Indx1
ISB_CA_AR.T2 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTGCCTTCCCGATATCCGACGG Indx2
ISB_CA_AR.T3 CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG Indx3

PCR Test

Components 1X Volume 4X Volume
Captured template 1 0
10uM ISB_CA_AF 0.4 1.6
10uM ISB_CA_AR.T1 0.4 1.6
2X KAPA SYBG MM 12.5 50
H2O 10.7 42.8
Total 25 96
  • Aliquot 24ul from 4X master mix and add 1ul captured template
 Program
 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min

File:20161119 CA12kOct2016V4 invitroCapture PCRtest.JPG

PCR

Components 1X Volume 3.5X Volume
Captured template 12 0
10uM Forward Primer 2 7
10uM Reverse Primer 2 0
2X KAPA SYBG MM 50 175
H2O 34 119
Total 100 301
  • Indx1:T4
  • Indx2:SplintR
  • Indx3:Ampligase
  • Aliquot 86ul from 3.5X master mix and add 12ul captured template and 2ul corresponding reverse primer
 Program
 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min

File:20161203 invitro CA12kOct2016V4 PCR.png