Matt:LabNotes/2017-5-8: Difference between revisions
Jump to navigation
Jump to search
>Mzcai (Created page with "=Second Try: in tube SplintR Test with formamide and ET SSB= *[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of...") |
>Mzcai m (→Protocol) |
||
Line 36: | Line 36: | ||
| width="51" height="14" | Sample # | | width="51" height="14" | Sample # | ||
| width="96" | Condition | | width="96" | Condition | ||
| width="51" | | | width="51" | 10nM PP + Template | ||
| width="51" | 10X Buffer | | width="51" | 10X Buffer | ||
| width="51" | Formamide | | width="51" | Formamide | ||
Line 45: | Line 45: | ||
| align="right" height="14" | 1 | | align="right" height="14" | 1 | ||
| SplintR | | SplintR | ||
| 1.5 or 1.8 (0.3ul of each | | 1.5 or 1.8 (0.3ul of each 1uM oligo) | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 0 | | align="right" | 0 | ||
Line 54: | Line 54: | ||
| align="right" height="14" | 2 | | align="right" height="14" | 2 | ||
| SplintR + 5% formamide | | SplintR + 5% formamide | ||
| 1.5 or 1.8 (0.3ul of each | | 1.5 or 1.8 (0.3ul of each 1uM oligo) | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 1.5 | | align="right" | 1.5 | ||
Line 63: | Line 63: | ||
| align="right" height="14" | 3 | | align="right" height="14" | 3 | ||
| SplintR + 7.5% formamide | | SplintR + 7.5% formamide | ||
| 1.5 or 1.8 (0.3ul of each | | 1.5 or 1.8 (0.3ul of each 1uM oligo) | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 2.25 | | align="right" | 2.25 | ||
Line 72: | Line 72: | ||
| align="right" height="14" | 4 | | align="right" height="14" | 4 | ||
| SplintR + 10% formamide | | SplintR + 10% formamide | ||
| 1.5 or 1.8 (0.3ul of each | | 1.5 or 1.8 (0.3ul of each 1uM oligo) | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 3 | | align="right" | 3 | ||
Line 81: | Line 81: | ||
| align="right" height="14" | 5 | | align="right" height="14" | 5 | ||
| SplintR + 12.5% formamide | | SplintR + 12.5% formamide | ||
| 1.5 or 1.8 (0.3ul of each | | 1.5 or 1.8 (0.3ul of each 1uM oligo) | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 3.75 | | align="right" | 3.75 | ||
Line 90: | Line 90: | ||
| align="right" height="14" | 6 | | align="right" height="14" | 6 | ||
| SplintR + 15% formamide | | SplintR + 15% formamide | ||
| 1.5 or 1.8 (0.3ul of each | | 1.5 or 1.8 (0.3ul of each 1uM oligo) | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 4.5 | | align="right" | 4.5 | ||
Line 99: | Line 99: | ||
| align="right" height="14" | 7 | | align="right" height="14" | 7 | ||
| SplintR + 10% formamide + ET SSB | | SplintR + 10% formamide + ET SSB | ||
| 1.5 or 1.8 (0.3ul of each | | 1.5 or 1.8 (0.3ul of each 1uM oligo) | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 3 | | align="right" | 3 | ||
Line 108: | Line 108: | ||
| align="right" height="14" | 8 | | align="right" height="14" | 8 | ||
| Ampligase | | Ampligase | ||
| 1.5 or 1.8 (0.3ul of each | | 1.5 or 1.8 (0.3ul of each 1uM oligo) | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 0 | | align="right" | 0 |
Revision as of 01:53, 9 May 2017
Second Try: in tube SplintR Test with formamide and ET SSB
- First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried
- Will try varying formamide concentration around 10%
- Will qPCR with lower starting conc to get more accurate measurement
Test Conditions
- Standard: SplintR only
- SplintR + 5% formamide
- SplintR + 7.5% formamide
- SplintR + 10% formamide
- SplintR + 12.5% formamide
- SplintR + 15% formamide
- SplintR + 10% formamide + 250ng ET SSB
- Positive Control: Ampligase
- For each test conditions have
- one sample with ALL padlock probes and template
- Should see amplification
- one sample with all padlock probes with NO MALAT1 template
- Should not see amplification
- one sample with ALL padlock probes and template
Padlock Probes and Template
- ppCUX2
- ppBCL11B
- ppRELN_1
- ppGFAP
- ppMALAT1
- /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
- Template for ppMALAT1: MALAT1_template
- /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT
Protocol
Sample # | Condition | 10nM PP + Template | 10X Buffer | Formamide | H2O | Total |
1 | SplintR | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 0 | 25.5 or 25.2 | 30 |
2 | SplintR + 5% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 1.5 | 24 or 23.7 | 30 |
3 | SplintR + 7.5% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 2.25 | 23.25 or 22.95 | 30 |
4 | SplintR + 10% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 3 | 22.5 or 22.2 | 30 |
5 | SplintR + 12.5% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 3.75 | 21.75 or 21.45 | 30 |
6 | SplintR + 15% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 4.5 | 21 or 20.7 | 30 |
7 | SplintR + 10% formamide + ET SSB | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 3 | 22.5 or 22.2 | 30 |
8 | Ampligase | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 0 | 25.5 or 25.2 | 30 |
- Combine padlock probes and template in 1X Ligase buffer and possibly formamide
- Add mineral oil on top
- Incubate at 55C for 17hr