Matt:LabNotes/2017-5-8: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
>Mzcai
mNo edit summary
Line 118: Line 118:
#Combine padlock probes and template in 1X Ligase buffer and possibly formamide
#Combine padlock probes and template in 1X Ligase buffer and possibly formamide
#Add mineral oil on top
#Add mineral oil on top
#Incubate at 55C for 17hr<!--
#Incubate at 55C for 18hr
#To sample 7 (2-step ET SSB) add 200ng (0.4ul) of ET SSB and keep at 55C for 30min
#To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
#To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
#*Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
#*Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
#After sample 7 has ET SSB for 30min move samples 1-7 to 37C
#Move samples 1-7 to 37C
#Add 3ul SplintR Mix and incubate 15min
#Add 3ul SplintR Mix and incubate 15min
#*SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
#*SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
#*30min incubation for sample 2
#*Also add 0.4ul ET SSB to sample 7
#*Also add 0.4ul ET SSB to sample 6
#Incubate at 94C for 10min
#Put all samples on ice and add 2ul Exo I/III mix
#Put all samples on ice and add 2ul Exo I/III mix
#*Also add 0.4ul ET SSB to samples 1-5 and 8
#*Also add 0.4ul ET SSB to samples 1-6 and 8
#Incubate at 37C for 1hr
#Incubate at 37C for 1hr
#Incubate at 94C for 10min
#qPCR all 16 samples
#qPCR all 16 samples
 
<!--
{| {{table}}
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Components'''
| align="center" style="background:#f0f0f0;"|'''Components'''

Revision as of 20:39, 9 May 2017

Second Try: in tube SplintR Test with formamide and ET SSB

Test Conditions

  1. Standard: SplintR only
  2. SplintR + 5% formamide
  3. SplintR + 7.5% formamide
  4. SplintR + 10% formamide
  5. SplintR + 12.5% formamide
  6. SplintR + 15% formamide
  7. SplintR + 10% formamide + 250ng ET SSB
  8. Positive Control: Ampligase
  • For each test conditions have
    • one sample with ALL padlock probes and template
      • Should see amplification
    • one sample with all padlock probes with NO MALAT1 template
      • Should not see amplification

Padlock Probes and Template

  • ppCUX2
  • ppBCL11B
  • ppRELN_1
  • ppGFAP
  • ppMALAT1
    • /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
  • Template for ppMALAT1: MALAT1_template
    • /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT

Protocol

Sample # Condition 10nM PP + Template 10X Buffer Formamide H2O Total
1 SplintR 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 0 25.5 or 25.2 30
2 SplintR + 5% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 1.5 24 or 23.7 30
3 SplintR + 7.5% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 2.25 23.25 or 22.95 30
4 SplintR + 10% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 3 22.5 or 22.2 30
5 SplintR + 12.5% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 3.75 21.75 or 21.45 30
6 SplintR + 15% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 4.5 21 or 20.7 30
7 SplintR + 10% formamide + ET SSB 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 3 22.5 or 22.2 30
8 Ampligase 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 0 25.5 or 25.2 30
  1. Combine padlock probes and template in 1X Ligase buffer and possibly formamide
  2. Add mineral oil on top
  3. Incubate at 55C for 18hr
  4. To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
    • Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
  5. Move samples 1-7 to 37C
  6. Add 3ul SplintR Mix and incubate 15min
    • SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
    • Also add 0.4ul ET SSB to sample 7
  7. Incubate at 94C for 10min
  8. Put all samples on ice and add 2ul Exo I/III mix
    • Also add 0.4ul ET SSB to samples 1-6 and 8
  9. Incubate at 37C for 1hr
  10. Incubate at 94C for 10min
  11. qPCR all 16 samples