Matt:LabNotes/2017-5-8: Difference between revisions
Jump to navigation
Jump to search
>Mzcai mNo edit summary |
>Mzcai |
||
(One intermediate revision by the same user not shown) | |||
Line 191: | Line 191: | ||
98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min | 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min | ||
[[File:20170515_qPCR_PPcapture_SplintRformamideETSSB_triplicates_ScatterPlot.PNG|450px]] | |||
*Full analysis here: [[Media:20170515_qPCR_PPcapture_SplintRformamideETSSB.xlsx]] | |||
==Zymo column purify and Repeat qPCR== | ==Zymo column purify and Repeat qPCR== | ||
Line 218: | Line 220: | ||
Program | Program | ||
98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min | 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min | ||
[[File:20170515_qPCR_PPcapture_SplintRformamideETSSB_purified_ScatterPlot.PNG|450px]] |
Latest revision as of 00:23, 3 June 2017
Second Try: in tube SplintR Test with formamide and ET SSB[edit]
- First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried
- Will try varying formamide concentration around 10%
- Will qPCR with lower starting conc to get more accurate measurement
Test Conditions[edit]
- Standard: SplintR only
- SplintR + 5% formamide
- SplintR + 7.5% formamide
- SplintR + 10% formamide
- SplintR + 12.5% formamide
- SplintR + 15% formamide
- SplintR + 10% formamide + 250ng ET SSB
- Positive Control: Ampligase
- For each test conditions have
- one sample with ALL padlock probes and template
- Should see amplification
- one sample with all padlock probes with NO MALAT1 template
- Should not see amplification
- one sample with ALL padlock probes and template
Padlock Probes and Template[edit]
- ppCUX2
- ppBCL11B
- ppRELN_1
- ppGFAP
- ppMALAT1
- /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
- Template for ppMALAT1: MALAT1_template
- /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT
Protocol[edit]
Sample # | Condition | 10nM PP + Template | 10X Buffer | Formamide | H2O | Total |
1 | SplintR | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 0 | 25.5 or 25.2 | 30 |
2 | SplintR + 5% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 1.5 | 24 or 23.7 | 30 |
3 | SplintR + 7.5% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 2.25 | 23.25 or 22.95 | 30 |
4 | SplintR + 10% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 3 | 22.5 or 22.2 | 30 |
5 | SplintR + 12.5% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 3.75 | 21.75 or 21.45 | 30 |
6 | SplintR + 15% formamide | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 4.5 | 21 or 20.7 | 30 |
7 | SplintR + 10% formamide + ET SSB | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 3 | 22.5 or 22.2 | 30 |
8 | Ampligase | 1.5 or 1.8 (0.3ul of each 1uM oligo) | 3 | 0 | 25.5 or 25.2 | 30 |
- Combine padlock probes and template in 1X Ligase buffer and possibly formamide
- Add mineral oil on top
- Incubate at 55C for 18hr
- To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
- Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
- Move samples 1-7 to 37C
- Add 3ul SplintR Mix and incubate 15min
- SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
- Also add 0.4ul ET SSB to sample 7
- Incubate at 94C for 10min
- Put all samples on ice and add 2ul Exo I/III mix
- Incubate at 37C for 1.5hr
- Incubate at 94C for 10min
- qPCR all 16 samples
Components | 1X Volume | 16X Volume |
Captured template | 5 | 0 |
10uM ISB_CA_AF | 0.4 | 6.4 |
10uM ISB_CA_AR.T1 | 0.4 | 6.4 |
2X KAPA SYBG MM | 12.5 | 200 |
H2O | 6.7 | 107.2 |
Total | 25 | 320 |
- Aliquot 20ul from 16X master mix and add 5ul captured template
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min
Results[edit]
raw data here
File:20170510 qPCR PPcapture SplintRformamideETSSB.PNG
- Only Ampligase stands out from the rest
File:20170510 qPCR PPcapture SplintRformamideETSSB ScatterPlot.PNG
- 12.5% formamide has the best sensitivity and seperation from NTC (specificity)
- BUT 0%-10% formamide should all have higher sensitivity...
- These results don't make sense
- First try repeating PCR with triplicates and lower conc. (maybe Zymo column purify first)
- Then try repeating experiment with concentrations that match actual conc. (100-200nM total)
Repeat qPCR[edit]
- qPCR all 16 samples 1ul each with triplicates
Components | 1X Volume | 48X Volume |
Captured template | 1 | 0 |
10uM ISB_CA_AF | 0.4 | 19.2 |
10uM ISB_CA_AR.T2 | 0.4 | 19.2 |
2X KAPA SYBG MM | 12.5 | 600 |
H2O | 10.7 | 513.6 |
Total | 25 | 1,152 |
- Aliquot 24ul from 48X master mix and add 1ul captured template
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min
File:20170515 qPCR PPcapture SplintRformamideETSSB triplicates ScatterPlot.PNG
- Full analysis here: Media:20170515_qPCR_PPcapture_SplintRformamideETSSB.xlsx
Zymo column purify and Repeat qPCR[edit]
- Purify ssDNA from 20ul of 16 samples
- Elute 10ul each
- qPCR all 16 samples 1ul each with triplicates
Components | 1X Volume | 48X Volume |
Captured template | 1 | 0 |
10uM ISB_CA_AF | 0.4 | 19.2 |
10uM ISB_CA_AR.T2 | 0.4 | 19.2 |
2X KAPA SYBG MM | 12.5 | 600 |
H2O | 10.7 | 513.6 |
Total | 25 | 1,152 |
- Aliquot 24ul from 48X master mix and add 1ul captured template
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min
File:20170515 qPCR PPcapture SplintRformamideETSSB purified ScatterPlot.PNG