Matt:LabNotes/2017-5-8: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
No edit summary
>Mzcai
 
Line 192: Line 192:


[[File:20170515_qPCR_PPcapture_SplintRformamideETSSB_triplicates_ScatterPlot.PNG|450px]]
[[File:20170515_qPCR_PPcapture_SplintRformamideETSSB_triplicates_ScatterPlot.PNG|450px]]
*Full analysis here: [[Media:20170515_qPCR_PPcapture_SplintRformamideETSSB.xlsx]]


==Zymo column purify and Repeat qPCR==
==Zymo column purify and Repeat qPCR==

Latest revision as of 00:23, 3 June 2017

Second Try: in tube SplintR Test with formamide and ET SSB[edit]

Test Conditions[edit]

  1. Standard: SplintR only
  2. SplintR + 5% formamide
  3. SplintR + 7.5% formamide
  4. SplintR + 10% formamide
  5. SplintR + 12.5% formamide
  6. SplintR + 15% formamide
  7. SplintR + 10% formamide + 250ng ET SSB
  8. Positive Control: Ampligase
  • For each test conditions have
    • one sample with ALL padlock probes and template
      • Should see amplification
    • one sample with all padlock probes with NO MALAT1 template
      • Should not see amplification

Padlock Probes and Template[edit]

  • ppCUX2
  • ppBCL11B
  • ppRELN_1
  • ppGFAP
  • ppMALAT1
    • /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
  • Template for ppMALAT1: MALAT1_template
    • /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT

Protocol[edit]

Sample # Condition 10nM PP + Template 10X Buffer Formamide H2O Total
1 SplintR 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 0 25.5 or 25.2 30
2 SplintR + 5% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 1.5 24 or 23.7 30
3 SplintR + 7.5% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 2.25 23.25 or 22.95 30
4 SplintR + 10% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 3 22.5 or 22.2 30
5 SplintR + 12.5% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 3.75 21.75 or 21.45 30
6 SplintR + 15% formamide 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 4.5 21 or 20.7 30
7 SplintR + 10% formamide + ET SSB 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 3 22.5 or 22.2 30
8 Ampligase 1.5 or 1.8 (0.3ul of each 1uM oligo) 3 0 25.5 or 25.2 30
  1. Combine padlock probes and template in 1X Ligase buffer and possibly formamide
  2. Add mineral oil on top
  3. Incubate at 55C for 18hr
  4. To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
    • Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
  5. Move samples 1-7 to 37C
  6. Add 3ul SplintR Mix and incubate 15min
    • SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
    • Also add 0.4ul ET SSB to sample 7
  7. Incubate at 94C for 10min
  8. Put all samples on ice and add 2ul Exo I/III mix
  9. Incubate at 37C for 1.5hr
  10. Incubate at 94C for 10min
  11. qPCR all 16 samples
Components 1X Volume 16X Volume
Captured template 5 0
10uM ISB_CA_AF 0.4 6.4
10uM ISB_CA_AR.T1 0.4 6.4
2X KAPA SYBG MM 12.5 200
H2O 6.7 107.2
Total 25 320
  • Aliquot 20ul from 16X master mix and add 5ul captured template
 Program
 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min

Results[edit]

raw data here
File:20170510 qPCR PPcapture SplintRformamideETSSB.PNG

  • Only Ampligase stands out from the rest

File:20170510 qPCR PPcapture SplintRformamideETSSB ScatterPlot.PNG

  • 12.5% formamide has the best sensitivity and seperation from NTC (specificity)
  • BUT 0%-10% formamide should all have higher sensitivity...
  • These results don't make sense
    • First try repeating PCR with triplicates and lower conc. (maybe Zymo column purify first)
    • Then try repeating experiment with concentrations that match actual conc. (100-200nM total)

Repeat qPCR[edit]

  1. qPCR all 16 samples 1ul each with triplicates
Components 1X Volume 48X Volume
Captured template 1 0
10uM ISB_CA_AF 0.4 19.2
10uM ISB_CA_AR.T2 0.4 19.2
2X KAPA SYBG MM 12.5 600
H2O 10.7 513.6
Total 25 1,152
  • Aliquot 24ul from 48X master mix and add 1ul captured template
 Program
 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min

File:20170515 qPCR PPcapture SplintRformamideETSSB triplicates ScatterPlot.PNG

Zymo column purify and Repeat qPCR[edit]

  1. Purify ssDNA from 20ul of 16 samples
  2. Elute 10ul each
  3. qPCR all 16 samples 1ul each with triplicates
Components 1X Volume 48X Volume
Captured template 1 0
10uM ISB_CA_AF 0.4 19.2
10uM ISB_CA_AR.T2 0.4 19.2
2X KAPA SYBG MM 12.5 600
H2O 10.7 513.6
Total 25 1,152
  • Aliquot 24ul from 48X master mix and add 1ul captured template
 Program
 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min

File:20170515 qPCR PPcapture SplintRformamideETSSB purified ScatterPlot.PNG