Matt:LabNotes/2017-5-15: Difference between revisions
Jump to navigation
Jump to search
>Mzcai (Created page with "=Third Try: in tube SplintR Test with formamide and ET SSB= *[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of ...") |
>Mzcai m (→Protocol) |
||
Line 110: | Line 110: | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 0 | | align="right" | 0 | ||
| 22.5 | | 25.2 or 22.5 (these were added before realizing wrong volume. Kept as is) | ||
| align="right" | 30 | | align="right" | 30 | ||
Revision as of 23:44, 16 May 2017
Third Try: in tube SplintR Test with formamide and ET SSB
- First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried
- Second try had unexpected trend with increasing formamide led to increased sensitivity
- Will try again with replicates and match padlock probe concentration to actual experiment (~150nM)
Test Conditions
- Standard: SplintR only
- SplintR + 5% formamide
- SplintR + 7.5% formamide
- SplintR + 10% formamide
- SplintR + 12.5% formamide
- SplintR + 15% formamide
- SplintR + 17.5% formamide
- Positive Control: Ampligase
- For each test conditions have
- one sample with ALL padlock probes and template
- Should see amplification
- one sample with all padlock probes with NO MALAT1 template
- Should not see amplification
- one sample with ALL padlock probes and template
Padlock Probes and Template
- ppCUX2
- ppBCL11B
- ppRELN_1
- ppGFAP
- ppMALAT1
- /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
- Template for ppMALAT1: MALAT1_template
- /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT
Protocol
Sample # | Condition | 30nM PP + Template | 10X Buffer | Formamide | H2O | Total |
1 | SplintR | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 22.5 or 21.6 | 30 |
2 | SplintR + 5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 1.5 | 21 or 20.1 | 30 |
3 | SplintR + 7.5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 2.25 | 20.25 or 19.35 | 30 |
4 | SplintR + 10% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 3 | 19.5 or 18.6 | 30 |
5 | SplintR + 12.5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 3.75 | 18.75 or 17.85 | 30 |
6 | SplintR + 15% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 4.5 | 18 or 17.1 | 30 |
7 | SplintR + 17.5 formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 5.25 | 17.25 or 16.35 | 30 |
8 | Ampligase | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 25.2 or 22.5 (these were added before realizing wrong volume. Kept as is) | 30 |
- Combine padlock probes and template in 1X Ligase buffer and possibly formamide
- Add mineral oil on top
- Incubate at 55C for 18hr