Matt:LabNotes/2017-5-19: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
(Created page with "=Third Try: in tube SplintR Test with formamide and ET SSB= *[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of ...")
 
>Mzcai
Line 1: Line 1:
=Third Try: in tube SplintR Test with formamide and ET SSB=
=Third Try: in tube SplintR Test with formamide and ET SSB=
*[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried]]
*[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried]]
*[[Matt:LabNotes/2017-5-8|Second try had unexpected trend with increasing formamide led to increased sensitivity]
*[[Matt:LabNotes/2017-5-8|Second try had unexpected trend with increasing formamide led to increased sensitivity]]
*[[Matt:LabNotes/2017-5-15|Third try confirmed second try]]
*[[Matt:LabNotes/2017-5-15|Third try confirmed second try]]


Line 119: Line 119:
#Combine padlock probes and template in 1X Ligase buffer and possibly formamide
#Combine padlock probes and template in 1X Ligase buffer and possibly formamide
#Add mineral oil on top
#Add mineral oil on top
#Incubate at 94C for 3min
#Incubate at 95C for 3min
#Incubate at 55C for 18hr<!--
#Incubate at 55C for 18hr<!--
#To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
#To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min

Revision as of 21:48, 19 May 2017

Third Try: in tube SplintR Test with formamide and ET SSB

  • Try with 95C 3min denature before hybridization

Test Conditions

  1. Standard: SplintR only
  2. SplintR + 5% formamide
  3. SplintR + 7.5% formamide
  4. SplintR + 10% formamide
  5. SplintR + 12.5% formamide
  6. SplintR + 15% formamide
  7. SplintR + 17.5% formamide
  8. Positive Control: Ampligase
  • For each test conditions have
    • one sample with ALL padlock probes and template
      • Should see amplification
    • one sample with all padlock probes with NO MALAT1 template
      • Should not see amplification

Padlock Probes and Template

  • ppCUX2
  • ppBCL11B
  • ppRELN_1
  • ppGFAP
  • ppMALAT1
    • /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
  • Template for ppMALAT1: MALAT1_template
    • /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT

Protocol

Sample # Condition 30nM PP + Template 10X Buffer Formamide H2O Total
1 SplintR 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 22.5 or 21.6 30
2 SplintR + 5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 1.5 21 or 20.1 30
3 SplintR + 7.5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 2.25 20.25 or 19.35 30
4 SplintR + 10% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 3 19.5 or 18.6 30
5 SplintR + 12.5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 3.75 18.75 or 17.85 30
6 SplintR + 15% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 4.5 18 or 17.1 30
7 SplintR + 17.5 formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 5.25 17.25 or 16.35 30
8 Ampligase 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 25.2 or 22.5 (these were added before realizing wrong volume. Kept as is) 30
  1. Combine padlock probes and template in 1X Ligase buffer and possibly formamide
  2. Add mineral oil on top
  3. Incubate at 95C for 3min
  4. Incubate at 55C for 18hr