Chris:LabNotes/sci-Methyl Seq/Calendar/2017/2017-6-13: Difference between revisions
Jump to navigation
Jump to search
>Cjwei No edit summary |
>Cjwei |
||
Line 97: | Line 97: | ||
GTGTCTGCCACTGCCTCTCTTT 56.7 | GTGTCTGCCACTGCCTCTCTTT 56.7 | ||
TAGCCGACTGGGAAGTCCCCAT 58.6 Warning: There are more than 3 self-annealing bases; There are more than 3 hairpin bases | TAGCCGACTGGGAAGTCCCCAT 58.6 Warning: There are more than 3 self-annealing bases; There are more than 3 hairpin bases | ||
GGCCTACGACTACTGTCTGCGA 58.6 Warning: There are more than 3 self-annealing bases | GGCCTACGACTACTGTCTGCGA 58.6 Warning: There are more than 3 self-annealing bases (Also contains the HpyCH4III cut site in sequence) | ||
*Below are the potential Filler 2/3 (noG) sequences: | *Below are the potential Filler 2/3 (noG) sequences: | ||
Tm (C) Primer Stats Notes | Tm (C) Primer Stats Notes |
Revision as of 20:10, 13 June 2017
sci-Methyl Seq Barcode 1 Design v3; Barcode 2 Design v2
Background
- Just yesterday, we designed new sci-Methyl Seq Adapter 1 and Adapter 2 sequences and ordered them to test whether we could ligate on Adapter 2 instead of using the current annealing method. However, looking further into the protocol, it would be prudent to begin designing Adapter 1 such that it will be appropriate for bisulfite conversion and PCR. In order to do this, we need to do the following:
- Adjust Filler 2 such that it does not contain any G's, which would result in C's in the final sequence that may be bisulfite converted (making PCR inefficient/impossible as primers need a consistent binding site for adding the P5/P7 adapter regions)
- Begin testing the formation of dsDNA Adpt1/Adpt2. This would require using a method similar to the HpyCH4III digestion outlined here <http://www.nature.com/nprot/journal/v9/n11/box/nprot.2014.170_BX1.html> to create the T-tailed Adpt1. dsDNA Adpt2 can be created just by using polymerization/end-repair.
- Create final PCR primers that will add the P5/P7 sequencing adapters to both ends of the DNA fragment
Overview
- Below is a general overview of the experimental procedure to ligate Adpt1 and Adpt2 (same as <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-6-12> but with PCR added in)
End Repair/dA-Tailing 5' -----A 3' 3' A----- 5' | V Add Adpt1_v3: 5' /5Phos/-----TTDD[Barcode1]-----CC 3' 3' T-----AADD[Barcode1]----- 5' | V Ligate Adpt1_v3 (using same optimized ligation protocol as before) 5' -----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC 3' 3' CC-----[Barcode1]DDTT-----|A-----|T-----AADD[Barcode1]----- 5' | V Add Adpt2_v2: 5' /5Phos/-----[Barcode2]DDDDDDDD----- 3' 3' GG-----[Barcode2]DDDDDDDD----- 5' | V Ligate Adpt2_v2 (using same optimized ligation protocol as before) Nick V 5' -----DDDDDDDD[Barcode2]-----GG|-----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3' 3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]DDTT-----|A-----|T-----AADD[Barcode1]-----|GG-----[Barcode2]DDDDDDDD----- 5' ^ Nick | V Denature/separate fragments (will break up DNA at nicks) 5' -----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3' 3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]DDTT-----|A-----|T-----AADD[Barcode1]----- 5' | V Bisulfite conversion | V PCR, 1st cycle (Add P7 sequencing adapters) P5: 5' AATGATACGGCGACCACCGA 3' P7: 5' CAAGCAGAAGACGGCATACGAGAT 3' 5' -----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3' 3' <----- \ P7 5' 5' P7 \ -----> 3' 3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]DDTT-----|A-----|T-----AADD[Barcode1]----- 5' | V PCR, 2nd cycle (Add P5 sequencing adapters) 5' P5 \ -----> 3' 3' -----[Barcode1]DDTT-----A|-----T|-----AADD[Barcode1]-----GG|-----[Barcode2]DDDDDDDD-----P7 5' 5' P7-----DDDDDDDD[Barcode2]-----|GG-----[Barcode1]DDAA-----|T-----|A-----TTDD[Barcode1]----- 3' 3' <----- \ P5 5' | V PCR Product 5' P5-----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC|-----[Barcode2]DDDDDDDD-----P7 3'
Barcode 1 Adapter Design (Adpt1_v4)
- We want to further modify Adpt1 from Adpt1_v3 (which added the additional CC sticky end for Adpt2 ligation) by chainging the Filler 2 sequence such that it does not contain any G's. The reason for this is because we want the complementary sequence of Filler 2 (which would have C's) to be changed during bisulfite conversion.
- Below is the general design that we want to achieve with Adapter 1 (including the HpyCH4III cut site at the end):
Filler2 (originally Filler 2 sequence was GTCCCTCCTACCCGGCGTTT, but need to change such that no G's) | Filler1 (Originally was omitted in Adpt1 because was extraneous, but need to add back in order to form second strand) | | V V Adpt1_v4: 5' /5Phos/-----ACA|GT-----TTDD[Barcode1]-----CC 3' Adpt1_v4_comp: 3' ^ <----- 5' (Complementary to Filler 1 in order to do second strand synthesis) | Add 5bp flanking region that is enough for RE cut
- We want to ensure melting temperature of sequence is ~56C-60C (ideal temperature of 58C, which matches P5/P7 adapters) with a length of 18-30bp. Consequently, we want to rerun the primergenerator.py script again to generate more potential sequences (see more information on <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-3-13> and <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-4-28>). Below are the new parameters we want to set:
- Set the temperature options to: tmoupt=58, tmmin=56, tmmax=60
- Use the noG variant of the script in order to form Filler 2 and Filler 3 (Adpt2)
- Set length parameter (-l, --plength) to 22 in order to compensate for the slightly increased melting temperature
- Below are the potential Filler 1 sequences:
Tm (C) Primer Stats Notes (http://www.bioinformatics.org/sms2/pcr_primer_stats.html) GCACACATAGCACGACGCGATT 56.7 TTGACTGCTGTGGAGTCGTTCG 56.7 GTACCTCGCCCGTTACCTTCGT 58.6 Warning: There are more than 3 self-annealing bases GTTGGGCCGACACACTTGAGAA 56.7 TGAGGCTCACTATGCGATCCTC 56.7 Warning: There are more than 3 self-annealing bases; There are more than 3 hairpin bases AAGTGCGGACCCCCAATGCATC 58.6 Warning: There are more than 3 self-annealing bases GTGGGTCGACAAAGCATCCCCT 58.6 Warning; There are more than 3 Gs or Cs in the last 5 bases GTGTCTGCCACTGCCTCTCTTT 56.7 TAGCCGACTGGGAAGTCCCCAT 58.6 Warning: There are more than 3 self-annealing bases; There are more than 3 hairpin bases GGCCTACGACTACTGTCTGCGA 58.6 Warning: There are more than 3 self-annealing bases (Also contains the HpyCH4III cut site in sequence)
- Below are the potential Filler 2/3 (noG) sequences:
Tm (C) Primer Stats Notes CATCTCCACTACCCCCCAACCT 58.6 Warning: Contains run of C's TTCACCTCACCTTACCACCCCC 58.6 Warning: Contains run of C's; There are more than 3 G's or C's in the last 5 bases CAACCTCCACCTCACTCTCCTC 58.6 TCCATCTTCCCACCCATCTCCC 58.6 Warning: Contains run of C's; There are more than 3 G's or C's in the last 5 bases CCCCACACTCCCCCAAAACCAA 58.6 Warning: Contains run of C's TCCCCCCCCTCATACTCACTTC 58.6 Warning: Contains run of C's TCCCCCCCTCAACTCAACACTC 58.6 Warning: Contains run of C's TCCACACAACCCCCCAACCTCT 58.6 Warning: Contains run of C's TCCCTCCCATTATCTCCACCCT 56.7 ATTACATCCACCCCCCTCACTC 56.7 Warning: Contains run of C's