Chris:LabNotes/sci-Methyl Seq/Calendar/2017/2017-7-3: Difference between revisions
Jump to navigation
Jump to search
>Cjwei No edit summary |
>Cjwei |
||
Line 47: | Line 47: | ||
V | V | ||
Adpt1_v5: (second strand synthesis; cut by HpyCH4III and DraIII) | |||
5' -----<u>ACA|GT</u><span style="color:red">-----TTHH[Barcode1]-----</span><u>CACNNN|GTG</u>----- 3' | 5' -----<u>ACA|GT</u><span style="color:red">-----TTHH[Barcode1]-----</span><u>CACNNN|GTG</u>----- 3' | ||
3' <span style="color:blue"><-----</span><u>GTG|NNNCAC</u>----- 5' | 3' <span style="color:blue"><-----</span><u>GTG|NNNCAC</u>----- 5' | ||
Line 63: | Line 63: | ||
3' <u>TCA</u><span style="color:blue">-----AADD[''Barcode1'']-----</span><u>GTG</u> 5' | 3' <u>TCA</u><span style="color:blue">-----AADD[''Barcode1'']-----</span><u>GTG</u> 5' | ||
<u>Ligate | <u>Ligate Adpt1_v5 (using same optimized ligation protocol as before)</u> | ||
5' | 5' <u>GTG</u><span style="color:blue">-----[''Barcode1'']DDAA-----</span><u>ACT</u>|'''-----'''A|<u>GT</u><span style="color:red">-----TTHH[Barcode1]-----</span><u>CACNNN</u> 3' | ||
3' <span style="color:red"> | 3' <u>NNNCAC</u><span style="color:red">-----[Barcode1]HHTT-----</span><u>TG</u>|A'''-----'''|<u>TCA</u><span style="color:blue">-----AADD[''Barcode1'']-----</span><u>GTG</u> 5' | ||
| | | | ||
V | V | ||
<u>Add Adpt2_v3:</u> 5' /5Phos/<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span> 3' | <u>Add Adpt2_v3:</u> 5' /5Phos/<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span> 3' | ||
3' <span style="color:red">GG-----[Barcode2]'''HHHHHHHH'''-----</span> 5' | 3' <span style="color:red">GG-----[Barcode2]'''HHHHHHHH'''-----</span> 5' |
Revision as of 21:11, 3 July 2017
sci-Methyl Seq Barcode 1 Design v5; Barcode 2 Design v4
Background
- We want to make to major changes to the adapter designs:
- Adpt2 Y-Adapter Design:
- We want to redesign the adapter sequences in order to avoid having to use a single primer PCR reaction, which seems to be giving us some trouble. In addition, we would be unable to perform PCR after bisulfite conversion to add appropriate sequencing adapters since the ends of the fragments with Adp2 would contain the same sequence. Instead, we would need to use commercial kits to perform library construction (such as Accel-NGS Methyl-Seq <https://swiftbiosci.com/products/accel-ngs-methyl-seq-dna-library-kit/>). This could prove problematic as further optimization/cost would be added in order to use these commercial kits.
- Instead, we want to redesign Adpt2 to be Y-adapters with unique sequences on both strands that serve as primer binding sites. The general design would be as follows:
- Adpt2 Y-Adapter Design:
3' / / / 5' -----[Barcode2]UMI---- 3' <---- \ \ \ 5'
- Use 3-base sticky end for Adpt1/Adpt2 ligation:
- Previously, I've tried a CC/GG sticky end, which seems to still allow Adpt2 to be annealing directly onto the original template fragment non-specifically. Consequently, instead, we will try using a three-base sticky end to help with increasing specificity of Adpt1/Adpt2 ligation.
- To achieve this, we will use a restriction enzyme to cut the ends of Adpt1/Adpt2 in order to create the 3-base sticky end (use DraIII-HF from NEB).
- Use 3-base sticky end for Adpt1/Adpt2 ligation:
Note: NoG sequences in red/H, NoC sequences in blue/D HpyCH4III: ACN|GT TG|NCA DraIII: CACNNN|GTG GTG|NNNCAC Adpt1: (cut by HpyCH4III and DraIII) 5' /5Phos/GT-----TTHH[Barcode1]-----CACNNN 3' 3' TCA-----AADD[Barcode1]-----GTG 5' Adpt2: (cut by DraIII) 3' / / / 5' /5Phos/GTG-----[Barcode2]DDDDDDDD----- 3' NNNCAC-----[Barcode2]HHHHHHHH----- \ \ \ 5'
Overview
- Below is a general overview of the experimental procedure to ligate Adpt1 and Adpt2 (same as <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-6-12> but with PCR added in). NOTE: NoG sequences are in red/H, NoC sequences are in blue/D.
End Repair/dA-Tailing 5' -----A 3' 3' A----- 5' | V
Adpt1_v5: (second strand synthesis; cut by HpyCH4III and DraIII) 5' -----ACA|GT-----TTHH[Barcode1]-----CACNNN|GTG----- 3' 3' <-----GTG|NNNCAC----- 5' | Second strand synthesis V 5' -----ACA|GT-----TTHH[Barcode1]-----CACNNN|GTG----- 3' 3' -----TG|TCA-----AADD[Barcode1]-----GTG|NNNCAC----- 5' | Cut by HpyCH4III V 5' /5Phos/GT-----TTHH[Barcode1]-----CACNNN|GTG----- 3' 3' TCA-----AADD[Barcode1]-----GTG|NNNCAC----- 5' | Cut by DraIII V 5' /5Phos/GT-----TTHH[Barcode1]-----CACNNN 3' 3' TCA-----AADD[Barcode1]-----GTG 5'
Ligate Adpt1_v5 (using same optimized ligation protocol as before) 5' GTG-----[Barcode1]DDAA-----ACT|-----A|GT-----TTHH[Barcode1]-----CACNNN 3' 3' NNNCAC-----[Barcode1]HHTT-----TG|A-----|TCA-----AADD[Barcode1]-----GTG 5' | V
Add Adpt2_v3: 5' /5Phos/-----[Barcode2]DDDDDDDD----- 3' 3' GG-----[Barcode2]HHHHHHHH----- 5' | V Ligate Adpt2_v3 (using same optimized ligation protocol as before) Nick V 5' -----HHHHHHHH[Barcode2]-----GG|-----[Barcode1]DDAA-----ACT|-----A|GT-----TTHH[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3' 3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]HHTT-----TG|A-----|TCA-----AADD[Barcode1]-----|GG-----[Barcode2]HHHHHHHH----- 5' ^ Nick | V Denature/separate fragments (will break up DNA at nicks) 5' -----[Barcode1]DDAA-----ACT|-----A|GT-----TTHH[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3' 3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]HHTT-----TG|A-----|TCA-----AADD[Barcode1]----- 5' | V Bisulfite conversion (C->U) | V PCR (P7 will be added first followed by P5) P5: 5' AATGATACGGCGACCACCGA 3' P7: 5' CAAGCAGAAGACGGCATACGAGAT 3' 5' -----[Barcode1]DDAA-----AUT|-----A|GT-----TTHH[Barcode1]-----UU|-----[Barcode2]DDDDDDDD----- 3' ---------------------------------------------------------------------------------- 3' <----- -----> 3' \ / P7 5' 5' P5 P5 5' P7 / \ <----- -----> 3' ---------------------------------------------------------------------------------- 3' -----DDDDDDDD[Barcode2]-----|UU-----[Barcode1]HHTT-----TG|A-----|TUA-----AADD[Barcode1]----- 5' | V PCR Product 5' P5-----[Barcode1]DDAA-----AAT|-----A|GT-----TTHH[Barcode1]-----AA|-----[Barcode2]DDDDDDDD-----P7 3' -----> -----> -----> Index2 Primer Read1 Primer Index2 Primer