Jie:LabNotes/CpgSeq/2009-8-7: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Sam Chiang
No edit summary
>Sam Chiang
No edit summary
 
(8 intermediate revisions by the same user not shown)
Line 108: Line 108:


===PCR===
===PCR===
 
                                  x4
   Template                5ul        
   Template                10ul        
   2x iProof mix          50ul       
   2x iProof mix          50ul   200        
   Solexa_PCR_up (10uM)    4ul      
   Solexa_PCR_up (10uM)    4ul   16   
   Solexa_PCR_lo_PE (10uM) 4ul      
   Solexa_PCR_lo_PE (10uM) 4ul   16   
   H2O                    37ul      
   H2O                    37ul 148   
   50X SYBG I            0.2ul
   50X SYBG I            0.2ul 0.8
98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)->  
98C 30sec -> 4 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 8 cycles of (98C 10sec -> 72C 15 sec)->  
72C 3min -> 15C hold.
72C 3min -> 15C hold.


20090807_shotgun_lib_Parkinson_samples
[[Image:20090817_breast_cancer cell shotgun lib.jpg|300px]]20090817_breast cancer cell shotgun lib
[edit] quantification of shotgun library
 
20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix
 
gel quantification results:
Par_1: 6.14ng/ul x 40ul;
Par_9: 7.54ng/ul x 40ul;
PhiX lib: 7.43ng/ul (size 275-325bp)


Nanodrop results:
I did the e-gel size selection and quantification with Q-PCR
Par_1: 24.9ng/ul x 40ul;
Par_9: 21.8ng/ul x 40ul;
PhiX lib: 5.9ng/ul


[edit] quantification with qPCR
===quantification of PCR amplicons===
 
I dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM.
I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM.
I dilute the sample lib with 1:10 and 1:50 ratio.  
I dilute the Parkinson's lib with 1:10 ratio.  
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
                                     x 16
                                     x 14
   Template                1ul           
   Template                1ul           
   2x iProof mix          25ul        350
   2x iProof mix          25ul        350
Line 147: Line 135:
   50X SYBG I            0.2ul
   50X SYBG I            0.2ul


98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
 
 
Retrieved from "http://genome-tech.ucsd.edu/LabNotes/index.php/Jie:LabNotes/CpgSeq/2009-8-5"
Views
 
    * Jie
    * Discussion
    * Edit
    * History
    * Move
    * Watch
 
Personal tools
 
    * Sam Chiang
    * My talk
    * My preferences
    * My watchlist
    * My contributions
    * Log out
 
Navigation
 
    * Main Page
    * Current events
    * Recent changes
    * Random page
 
Investigators
 
    * Kun Zhang
    * Alice Li
    * Jie Deng
    * Athurva Gore
    * Jeff Gole
    * Alan Fung
    * Sam Chiang


Search
[[Media:20090817_quantification of breast cancer WBC.xls|20090817_quantification of breast cancer WBC]]
Toolbox


    * What links here
05192A18: 8.63nM;
    * Related changes
05192B09: 6.67nM;
    * Upload file
    * Special pages
    * Printable version
    * Permanent link

Latest revision as of 01:20, 18 August 2009

breast cancer patient peripheral blood DNA sample capture by cpg97k[edit]

gDNA extraction from blood[edit]

I used the Qiagen FlexiGene DNA kit to exact the DNA from blood. yield:
05192A18: 83.5ng/ul x 100ul;
05192B09: 72.7ng/ul x 100ul

Bisulfite conversion of patient DNA[edit]

No sample sample concentration sample volumn ddH2O conversion reagents conversed DNA concentration and volumn
05192A18 83.5ng/ul x 1 tube 20ul 0ul 130ul 148.2ng/ul x 10ul
05192B09 72.7ng/ulx 1 tubes 20ul 0ul 130ul 127.8ng/ul x 10ul


cpature by cpg97k[edit]

No sample sample concentration 10xLigase buffer template+cpg97k_A(60ng/ul_08/10) vol+suppress oligo+H2O template+cpg97k_B(60ng/ul_08/10) vol+suppressor oligo+H2O
05192A18 148.2ng/ul 1ul 3+1.5ul+1ul+3.5ul 3+1.5ul+1ul+3.5ul
05192B09 127.8ng/ul 1ul 3+1.5ul+1ul+3.5ul 3+1.5ul+1ul+3.5ul
PCR
Template                15ul        x4
2X iProof Mastermix     50ul     
AmpF6.3SoL (10uM)        4ul       
AmpR6.3SoL (10uM)        4ul          
50X SYBG I             0.4ul      
H2O                   26.6ul    
98C 30S -> (98C 10S -> 58C 20S -> 72C 20S) x 8 ->(98C 10S -> 72C 20S) x 8 ->72C 3 min -> 15C hold. 
Qiaquick purification and e-gel size selection. 

PCR amplification with AmpF6.3NH2/AmpR6.3NH2 and dUTP:dNTP 1:40[edit]

I did the dUTP_PCR with template from the Qiaquick purified captured targets of 97k. For each targets, I did 200ul PCR reaction.
reaction system                                                 x8     
H2O                                                42.6ul     340.8ul    
2x Master mix                                        50ul      400ul      
dUTP(1mM)                                             2ul       16ul       
AmpF6.3NH2(10uM)                                      2ul       16ul       
AmpR6.3NH2(10uM)                                      2ul       16ul     
50x SYBG I                                          0.4ul      3.2ul    
template                                          0.25ul/each for e-gel purified cpg97k
Total                                               100ul      1400ul
Purify with qiaquick column. Quantify with nanodrop and mix them with 1:1 ratio.

USER and S1 digestion[edit]

add 3ul USER to 30ul of each samples. 37C for 1h.
                                         
10 x S1 nuclease buffer:  4 ul           
DNA after USER digestion: 33ul            
S1 nuclease (10U/ul):      1ul            
ddH2O                      2ul           
37C 10mins.
Minelute cloumn purify. Elute in 18ul H2O.

endrepair with enzymatic end-repair kit[edit]

                                       x3
17 ul DNA 
2.5 ul 10X End-Repair Buffer           7.5
2.5 ul dNTP Mix                        7.5
 3  ul End-Repair Enzyme Mix            9
25  ul Total reaction volume

Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.

A tail addition[edit]

                                  x3
 Blunt-ended DNA        10ul      10 each
 10X Klenow buffer      1.6ul     4.8
 1mM dATP                3ul      9
 Klenow fragment (exo-)  1ul      3
 37C 30min, purified with MinElute columns, eluted with 12ul EB. 

adaptor ligation[edit]

                                              x4
   DNA                                10ul
   2x QuickLigase buffer (enzymatic)  15ul     60
   20uM Adaptor oligo mix              3ul     12
   T4 DNA QuickLigase (enzymatic)      2ul     8
   Incubate at RT for 15 minutes.
   Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.

PCR[edit]

                                 x4
  Template                10ul        
  2x iProof mix          50ul   200       
  Solexa_PCR_up (10uM)    4ul    16    
  Solexa_PCR_lo_PE (10uM) 4ul    16    
  H2O                     37ul  148     
  50X SYBG I             0.2ul  0.8

98C 30sec -> 4 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 8 cycles of (98C 10sec -> 72C 15 sec)-> 72C 3min -> 15C hold.

File:20090817 breast cancer cell shotgun lib.jpg20090817_breast cancer cell shotgun lib

I did the e-gel size selection and quantification with Q-PCR

quantification of PCR amplicons[edit]

I dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM.
I dilute the sample lib with 1:10 and 1:50 ratio. 
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
                                   x 16
 Template                 1ul          
 2x iProof mix           25ul        350
 syb_RP7 (100uM)        0.2ul        
 Syb_FP5 (100uM)        0.2ul        
 H2O                     24ul       
 50X SYBG I             0.2ul
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.

20090817_quantification of breast cancer WBC

05192A18: 8.63nM;
05192B09: 6.67nM;