AlanFung:LabNotes/Sequencing/2009-11-16: Difference between revisions
Jump to navigation
Jump to search
>Alan6017518 (New page: Construction of Solexa sequencing library from padlock captured PCR products using NEBNext DNA Sample Prep Master Mix Set 1 Kit (E6040S/L) *[http://www.neb.com/nebecomm/products/productE60...) |
>Alan6017518 |
||
(5 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
Construction of Solexa sequencing library from padlock captured PCR products using NEBNext DNA Sample Prep Master Mix Set 1 Kit (E6040S/L) | ==CVF-N== | ||
*Reamplify library and ship it out for shearing | |||
{| {{table}} | |||
| align="center" style="background:#f0f0f0;"|'''''' | |||
| align="center" style="background:#f0f0f0;"|'''''' | |||
| align="center" style="background:#f0f0f0;"|'''''' | |||
| align="center" style="background:#f0f0f0;"|'''x4''' | |||
| align="center" style="background:#f0f0f0;"|'''X1.1''' | |||
|- | |||
| Library||12||0.25||1||1.1 | |||
|- | |||
| 2X Phusion||50||50||200||220 | |||
|- | |||
| AmpF6.3NH2 (10uM)||2||2||8||8.8 | |||
|- | |||
| AmpR6.3NH2 (10uM)||2||2||8||8.8 | |||
|- | |||
| 10X SYBR Green I||2||2||8||8.8 | |||
|- | |||
| dH2O||32||43.75||175||192.5 | |||
|- | |||
| | |||
|} | |||
*98C 1min->6X(98C 10 sec, 58C 20 sec, 72C 20sec)->72C 5 min | |||
=Construction of Solexa sequencing library from padlock captured PCR products using NEBNext DNA Sample Prep Master Mix Set 1 Kit (E6040S/L)= | |||
*[http://www.neb.com/nebecomm/products/productE6040.asp Info] Read the FAQ!!! | *[http://www.neb.com/nebecomm/products/productE6040.asp Info] Read the FAQ!!! | ||
*[[Media:DNASPMMS1.pdf|Protocol]] | *[[Media:DNASPMMS1.pdf|Protocol]] | ||
Line 60: | Line 86: | ||
*Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube) | *Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube) | ||
*Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes. | *Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes. | ||
[[Image:ZhangLab_2 2009-11- | [[Image:ZhangLab_2 2009-11-16 15hr 00min.jpg]] | ||
*Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour). | *Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour). | ||
Latest revision as of 23:25, 17 November 2009
CVF-N[edit]
- Reamplify library and ship it out for shearing
' | ' | ' | x4 | X1.1 |
Library | 12 | 0.25 | 1 | 1.1 |
2X Phusion | 50 | 50 | 200 | 220 |
AmpF6.3NH2 (10uM) | 2 | 2 | 8 | 8.8 |
AmpR6.3NH2 (10uM) | 2 | 2 | 8 | 8.8 |
10X SYBR Green I | 2 | 2 | 8 | 8.8 |
dH2O | 32 | 43.75 | 175 | 192.5 |
- 98C 1min->6X(98C 10 sec, 58C 20 sec, 72C 20sec)->72C 5 min
Construction of Solexa sequencing library from padlock captured PCR products using NEBNext DNA Sample Prep Master Mix Set 1 Kit (E6040S/L)[edit]
- Info Read the FAQ!!!
- Protocol
- The NEBNext DNA SPMMS 1 (I) is compatible with protocols requiring a 3´ A overhang on the library molecules to facilitate ligation to adapters containing a 5´ T overhang, such as Illumina’s Genomic DNA Sample Prep protocol for the Genome Analyzer II.
- For 60bp run, we can use the library size of >180bp
- For 80bp runs, the lower limit for the sequencing libraries should be 200bp.
- If the library size is too small, some of the 80bp reads will reach to the other end of the adaptor sequences. we don't want to waste the sequencing $$ on the regions we don't want
- The total size of the adaptors is 105bp, and there is another ~25bp of the capturing arm
- The upper limit should be ~50bp above the lower limit
Overview[edit]
1-7 PGP1,8 PGP1 & 9 PGP1[edit]
- Fragmentation and end-polishing
- Size Selection
- Ligation
- PCR of sequencing Library
- QPCR quantification
Fragmentation and end-polishing (Make blunt ends with 5'P)[edit]
- The PCR amplicons (200ng-1ug) are fragmented with Covaris sonicator to ~100bp
- End-Repair Reactions
Fragmented DNA | 85ul |
10X End Repair Bufer | 10ul |
End Repair Enzyme Mix | 5ul |
- Incubate tubes at RT for 30minutes.
- Perform a Qiaquick purification and elute with 39ul EB buffer.
- NOTE: For blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the chance of getting chimeric reads.
- A-Tailing Reactions
Blunet-end DNA | 37ul |
10X dA-Tailing Reaction Buffer | 5ul |
Klenow Fragment (3'-5' exo-) | 3ul |
H2O | 5ul |
Incubated at 37C for 30min, purified with Qiaquick columns, eluted with 40 ul EB.
- Measure concentration with nanodrop
Size selection using Invitrogen 2% SizeSelect gel[edit]
- Fill any unused well with 30ul EB Buffer
- Mix 15ul EB buffer with 0.5ul ladder in a 0.2ml tube
- Load 20u end-polished DNA sample into two lanes(use 3 or more lanes if the starting DNA is more than 1ug)
- Run the SizeSelect program for 12~14 min. Pause when the 125bp band just move into the middle collection well
- Use pipette to extract all solution in each of the sample well, and quickly refill the wells with 20ul EB.
- Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube)
- Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes.
File:ZhangLab 2 2009-11-16 15hr 00min.jpg
- Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour).
Ligation. Blunt-end and TA ligations use the same protocol but slightly different adaptor sequences.[edit]
- Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time.
ul | |
End-repaired & size selected DNA | 36 |
40uM adaptor2 | 2 |
5X Quick Ligase Buffer | 10 |
Quick Ligase | 2 |
- Incubate at room temperature for 15 minutes, purified with MinElute columns, eluted with 20ul EB.
PCR of sequencing library[edit]
Solexa_PCR_up: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
AmpR6.3Sol: CAAGCAGAAGACGGCATACGAGCTCTTCGGAACGATGAGCCTCCAAC
AmpF6.3rSol: CAAGCAGAAGACGGCATACGAGCTCTTCCAGATGTTATCGAGGTCCGA
- prepare 2 master mix tube
F | R | |
10uM Solexa_PCR_up | 18 | 18 |
10uM AmpR6.3Sol | - | 18 |
10uM AmpF6.3Sol | 18 | - |
2X Phusion | 450 | 450 |
50X SYBR Green I | 3.6 | 3.6 |
H2O | 324 | 324 |
Ligation products | 10 | 10 |
10uM solexa PCR up | 2 | 2 |
10uM AmpR6.3Sol | 2 | - |
10uM AmpF6.3Sol | - | 2 |
2X Phusion | 50 | 50 |
50X SYBR Green I | 0.4 | 0.4 |
H2O | 36 | 36 |
- 90ul mix per well
- Setup
CVI-F CVI-R CVF-F CVF-R 1-7 PGP1-iPS-F 1-7 PGP1-iPS-R 9 PGP1-iPS-F 9 PGP1-iPS-R
PCR program: 98 °C 30sec -> 8 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold.
File:PCR of sequencing library.jpg
- TBE Gel verification (10well)
- 15ul h2o+4.5ul 6x loading dye+0.5ul 25bp ladder
- 15ul h2o+3ul 6X loading dye+2ul sampleFile:ZhangLab 2 2009-11-06 13hr 42min.jpg
- Mix the amplicons with two sets of primers
- Purified with Minelute columns, elute with 32ul EB buffer
TBE Gel Size Selection[edit]
- Run samples in 3 lanes and ladder in 2 lanes in in a 5-well TBE gel
- Load 2 lanes with 25bp ladder Mix in a .2ml tube(30ul H2O+9ul 6X loading dye+1ul 25bp ladder)/2
- Mix (30ul library + 15ul 6X loading dye + 15ul h20)/3 load to 3 wells