AlanFung:LabNotes/Sequencing/2009-12-1: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Alan6017518
(New page: ==Construction of CV-iB libraries with the USER/S1 protocol== ===PCR with dUTP=== *Mix CV-iB #A and #C at 3:1 ratio. 10ul A + 1ul C. *Mix CV-iB #B, #D, #E at 2:1:1 ratio. 4ul B + 4ul D +...)
 
>Alan6017518
 
(23 intermediate revisions by the same user not shown)
Line 22: Line 22:
| S1 Digestion||
| S1 Digestion||
|-
|-
| 10X S1 Nuclease Buffer||4
| 10X S1 Nuclease Buffer||8
|-
|-
| DNA after USER Digestion||33
| DNA after USER Digestion||66
|-
|-
| S1 Nuclease (10U/ul)||1
| S1 Nuclease (10U/ul)||2
|-
|-
| ddH2O||2
| ddH2O||4
|-
|-
|  
|  
Line 34: Line 34:


*37C 10mins
*37C 10mins
*Minelute purification. Elute w/16uH2O
*Minelute purification. Elute w/16uH2O x2 for each set
===End repair===
*Nanodrop
===A-tailing reaction===
A,C:20.7ng/ul*32ul=662.4ng
===Ligation===
B,D,E:32.1ng/ul*32ul=1027.2ng
===Size selection===
 
===PCR===
*Fragmentation and end-polishing
*Size Selection
*Ligation
*PCR of sequencing Library
*QPCR quantification
 
 
===Fragmentation and end-polishing (Make blunt ends with 5'P)===
*Make up to 85ul with dh2o (53ul each)
*End-Repair Reactions
  {| {{table}}
  | Fragmented DNA||  85ul
  |-
  | 10X End Repair Bufer||  10ul
  |-
  | End Repair Enzyme Mix||  5ul
  |-
  |
  |}
 
*Incubate tubes at RT for 30minutes.
*Perform a Qiaquick purification and elute with 40ul EB buffer.
Nanodrop
A,C: 12.1ng/ul*40ul=484ng
B,D,E: 19.1ng/ul*40ul=764ng
 
*NOTE: For blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the chance of getting chimeric reads.
 
*A-Tailing Reactions
{| {{table}}
| Blunet-end DNA||37ul
|-
| 10X dA-Tailing Reaction Buffer||5ul
|-
| Klenow Fragment (3'-5' exo-)||3ul
|-
| H2O||5ul
|-
|
|}
Incubated at 37C for 30min, purified with Qiaquick columns, eluted with 22 ul EB.
*Measure concentration with nanodrop
A,C: 14.4ng/ul*22ul=316.8ng
B,D,E: 24.7ng/ul*22ul=543.4ng
 
===Size selection using Invitrogen 2% SizeSelect gel===
*Fill any unused well with 30ul EB Buffer
*Mix 15ul EB buffer with 0.5ul ladder in a 0.2ml tube
*Load 20u end-polished DNA sample into two lanes(use 3 or more lanes if the starting DNA is more than 1ug)
*Run the SizeSelect program for 12~14 min. Pause when the 125bp band just move into the middle collection well
*Use pipette to extract all solution in each of the sample well, and quickly refill the wells with 20ul EB.
*Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube)
*Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes.
[[Image:ZhangLab_2 2009-12-01 12hr 31min.jpg]]
*Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour).
 
===Ligation. Blunt-end and TA ligations use the same protocol but slightly different adaptor sequences.===
 
* Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time.
{| {{table}}
| ||ul
|-
| End-repaired & size selected DNA||36
|-
| 40uM adaptor2||2
|-
| 5X Quick Ligase Buffer||10
|-
| Quick Ligase||2
|-
|
|}
*Incubate at room temperature for 15 minutes, purified with MinElute columns, eluted with 23ul EB.
Nanodrop
A,C: 15.9ng/ul*23ul=365.7ng
B,D,E: 15.6ng/ul*23ul=358.8ng
 
===PCR of sequencing library===
 
Solexa_PCR_up: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
 
AmpR6.3Sol:  CAAGCAGAAGACGGCATACGAGCTCTTCGGAACGATGAGCCTCCAAC
 
AmpF6.3rSol: CAAGCAGAAGACGGCATACGAGCTCTTCCAGATGTTATCGAGGTCCGA
 
*prepare 2 master mix tube
{| {{table}}
| align="center" style="background:#f0f0f0;"|''''''
| align="center" style="background:#f0f0f0;"|'''F'''
| align="center" style="background:#f0f0f0;"|'''R'''
|-
| 10uM Solexa_PCR_up||4.4||4.4
|-
| 10uM AmpR6.3Sol||0||4.4
|-
| 10uM AmpF6.3Sol||4.4||0
|-
| 2X Phusion||110||110
|-
| 50X SYBR Green I||0.88||0.88
|-
| H2O||79.2||79.2
|-
|
|}
 
{| {{table}}
| Ligation products||10||10
|-
| 10uM solexa PCR up||2||2
|-
| 10uM AmpR6.3Sol||2||-
|-
| 10uM AmpF6.3Sol||-||2
|-
| 2X Phusion||50||50
|-
| 50X SYBR Green I||0.4||0.4
|-
| H2O||36||36
|-
|
|}
*90ul mix per well
*Setup
 
 
 
PCR program: 98 °C 30sec -> 8 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold.
                                                                                               
*TBE Gel verification (10well)
*10ul h2o+4.5ul 6x loading dye+0.5ul 25bp ladder
*10ul h2o+3ul 6X loading dye+2ul sample
[[Image:ZhangLab_2 2009-12-01 15hr 00min.jpg]]
[[Image:ZhangLab_2 2009-12-01 15hr 27min.jpg]]
*Mix the amplicons with two sets of primers
*Purified with Minelute columns, elute with 13ul EB buffer
 
==QPCR Quantification==
 
Setup
Stock Phi-X (1nM)  CV-iB1 (1/10)  CV-F1 (1/10)      CV-iB-B,D,E (1/10)
Stock Phi-X (1nM)  CV-iB1 (1/10)  CV-F1 (1/10)      CV-iB-B,D,E (1/10)
Stock Phi-X (1nM)  CV-iB1 (1/10)  CV-F1 (1/10)      CV-iB-B,D,E (1/10)
Stock Phi-X (1nM)  CV-iB1 (1/10)  CV-F1 (1/10)      CV-iB-B,D,E (1/10)
Amp Phi-X (1nM)    CV-iF1 (1/10)  CV-iB-A,C (1/10)  PGP8A
Amp Phi-X (1nM)    CV-iF1 (1/10)  CV-iB-A,C (1/10)  PGP8A
Amp Phi-X (1nM)    CV-iF1 (1/10)  CV-iB-A,C (1/10)  PGP8A
Amp Phi-X (1nM)    CV-iF1 (1/10)  CV-iB-A,C (1/10)  PGP8A
{| {{table}}
| ||||X16||X1.1
|-
| DNA||2.000||||
|-
| Syb_FP5 (100uM)||0.200||3.200||3.520
|-
| Syb_RP7 (100uM)||0.200||3.200||3.520
|-
| 2X Phusion||25.000||400.000||440.000
|-
| 50X SYBR Green I||0.200||3.200||3.520
|-
| H20||24.000||384.000||422.400
|-
| ||||||872.960
|-
|
|}
*Dilute sample, 1ul in 9ul ddh2o
*mix 2ul 1/10 sample with 98ul mix
*aliquot 24ul to each well
98C 30 sec -> 20 cycles of (98C 10sec->64C 20sec->72C 20sec)->72C 5 min
{| {{table}}
| Result||||||||
|-
| PhiX||10.749||Cycle Difference||2^||x10 (nM)
|-
| CV-iB1||7.410||3.339||10.119||101.190
|-
| CV-iF1||7.664||3.085||8.486||84.855
|-
| CV-F1||7.320||3.429||10.770||107.704
|-
| CV-iB (A,C)||6.445||4.304||19.753||197.530
|-
| CV-iB (B,D,E)||6.459||4.290||19.562||195.622
|-
| PGP8A||6.636||4.113||17.304||
|-
|
|}
 
{| {{table}}
| Dilute to 10nM||Sample (ul)||ddH2O
|-
| CV-iB1||5.000||45.595
|-
| CV-iF1||5.000||37.428
|-
| CV-F1||5.000||48.852
|-
| CV-iB (A,C)||5.000||93.765
|-
| CV-iB (B,D,E)||5.000||92.811
|-
| PGP8A||5.000||3.652
|-
|
|}

Latest revision as of 03:16, 2 December 2009

Construction of CV-iB libraries with the USER/S1 protocol[edit]

PCR with dUTP[edit]

  • Mix CV-iB #A and #C at 3:1 ratio. 10ul A + 1ul C.
  • Mix CV-iB #B, #D, #E at 2:1:1 ratio. 4ul B + 4ul D + 3ul E.
                                  x2
    DNA                    10ul
    2X Taq Master mix:    200ul
    1mM dUTP:               8ul
    100uM AmpF6.3NH2:     0.8ul
    100uM AmpR6.3NH2:     0.8ul
    H2O                   181ul
    94C 2min -> 8x (94C 30sec -> 60C 30sec -> 72C 30sec) -> 72C 3min.
    Purify each amplicon with two Qiaquick columns.
    Elute w/ 32ul EB buffer in each tube.

USER digestion[edit]

    DNA  60ul
    USER  6ul
    37C 1 hour

S1 Nuclease digestion[edit]

S1 Digestion
10X S1 Nuclease Buffer 8
DNA after USER Digestion 66
S1 Nuclease (10U/ul) 2
ddH2O 4
  • 37C 10mins
  • Minelute purification. Elute w/16uH2O x2 for each set
  • Nanodrop
A,C:20.7ng/ul*32ul=662.4ng
B,D,E:32.1ng/ul*32ul=1027.2ng
  • Fragmentation and end-polishing
  • Size Selection
  • Ligation
  • PCR of sequencing Library
  • QPCR quantification


Fragmentation and end-polishing (Make blunt ends with 5'P)[edit]

  • Make up to 85ul with dh2o (53ul each)
  • End-Repair Reactions
Fragmented DNA 85ul
10X End Repair Bufer 10ul
End Repair Enzyme Mix 5ul
  • Incubate tubes at RT for 30minutes.
  • Perform a Qiaquick purification and elute with 40ul EB buffer.
Nanodrop
A,C: 12.1ng/ul*40ul=484ng
B,D,E: 19.1ng/ul*40ul=764ng
  • NOTE: For blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the chance of getting chimeric reads.
  • A-Tailing Reactions
Blunet-end DNA 37ul
10X dA-Tailing Reaction Buffer 5ul
Klenow Fragment (3'-5' exo-) 3ul
H2O 5ul

Incubated at 37C for 30min, purified with Qiaquick columns, eluted with 22 ul EB.

  • Measure concentration with nanodrop
A,C: 14.4ng/ul*22ul=316.8ng
B,D,E: 24.7ng/ul*22ul=543.4ng

Size selection using Invitrogen 2% SizeSelect gel[edit]

  • Fill any unused well with 30ul EB Buffer
  • Mix 15ul EB buffer with 0.5ul ladder in a 0.2ml tube
  • Load 20u end-polished DNA sample into two lanes(use 3 or more lanes if the starting DNA is more than 1ug)
  • Run the SizeSelect program for 12~14 min. Pause when the 125bp band just move into the middle collection well
  • Use pipette to extract all solution in each of the sample well, and quickly refill the wells with 20ul EB.
  • Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube)
  • Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes.

File:ZhangLab 2 2009-12-01 12hr 31min.jpg

  • Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour).

Ligation. Blunt-end and TA ligations use the same protocol but slightly different adaptor sequences.[edit]

  • Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time.
ul
End-repaired & size selected DNA 36
40uM adaptor2 2
5X Quick Ligase Buffer 10
Quick Ligase 2
  • Incubate at room temperature for 15 minutes, purified with MinElute columns, eluted with 23ul EB.
Nanodrop
A,C: 15.9ng/ul*23ul=365.7ng
B,D,E: 15.6ng/ul*23ul=358.8ng

PCR of sequencing library[edit]

Solexa_PCR_up: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

AmpR6.3Sol: CAAGCAGAAGACGGCATACGAGCTCTTCGGAACGATGAGCCTCCAAC

AmpF6.3rSol: CAAGCAGAAGACGGCATACGAGCTCTTCCAGATGTTATCGAGGTCCGA

  • prepare 2 master mix tube
' F R
10uM Solexa_PCR_up 4.4 4.4
10uM AmpR6.3Sol 0 4.4
10uM AmpF6.3Sol 4.4 0
2X Phusion 110 110
50X SYBR Green I 0.88 0.88
H2O 79.2 79.2
Ligation products 10 10
10uM solexa PCR up 2 2
10uM AmpR6.3Sol 2 -
10uM AmpF6.3Sol - 2
2X Phusion 50 50
50X SYBR Green I 0.4 0.4
H2O 36 36
  • 90ul mix per well
  • Setup


PCR program: 98 °C 30sec -> 8 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold.

  • TBE Gel verification (10well)
  • 10ul h2o+4.5ul 6x loading dye+0.5ul 25bp ladder
  • 10ul h2o+3ul 6X loading dye+2ul sample

File:ZhangLab 2 2009-12-01 15hr 00min.jpg File:ZhangLab 2 2009-12-01 15hr 27min.jpg

  • Mix the amplicons with two sets of primers
  • Purified with Minelute columns, elute with 13ul EB buffer

QPCR Quantification[edit]

Setup
Stock Phi-X (1nM)   CV-iB1 (1/10)   CV-F1 (1/10)      CV-iB-B,D,E (1/10)
Stock Phi-X (1nM)   CV-iB1 (1/10)   CV-F1 (1/10)      CV-iB-B,D,E (1/10)
Stock Phi-X (1nM)   CV-iB1 (1/10)   CV-F1 (1/10)      CV-iB-B,D,E (1/10)
Stock Phi-X (1nM)   CV-iB1 (1/10)   CV-F1 (1/10)      CV-iB-B,D,E (1/10)
Amp Phi-X (1nM)     CV-iF1 (1/10)   CV-iB-A,C (1/10)  PGP8A
Amp Phi-X (1nM)     CV-iF1 (1/10)   CV-iB-A,C (1/10)  PGP8A
Amp Phi-X (1nM)     CV-iF1 (1/10)   CV-iB-A,C (1/10)  PGP8A
Amp Phi-X (1nM)     CV-iF1 (1/10)   CV-iB-A,C (1/10)  PGP8A
X16 X1.1
DNA 2.000
Syb_FP5 (100uM) 0.200 3.200 3.520
Syb_RP7 (100uM) 0.200 3.200 3.520
2X Phusion 25.000 400.000 440.000
50X SYBR Green I 0.200 3.200 3.520
H20 24.000 384.000 422.400
872.960
  • Dilute sample, 1ul in 9ul ddh2o
  • mix 2ul 1/10 sample with 98ul mix
  • aliquot 24ul to each well
98C 30 sec -> 20 cycles of (98C 10sec->64C 20sec->72C 20sec)->72C 5 min
Result
PhiX 10.749 Cycle Difference 2^ x10 (nM)
CV-iB1 7.410 3.339 10.119 101.190
CV-iF1 7.664 3.085 8.486 84.855
CV-F1 7.320 3.429 10.770 107.704
CV-iB (A,C) 6.445 4.304 19.753 197.530
CV-iB (B,D,E) 6.459 4.290 19.562 195.622
PGP8A 6.636 4.113 17.304
Dilute to 10nM Sample (ul) ddH2O
CV-iB1 5.000 45.595
CV-iF1 5.000 37.428
CV-F1 5.000 48.852
CV-iB (A,C) 5.000 93.765
CV-iB (B,D,E) 5.000 92.811
PGP8A 5.000 3.652