Sam:LabNotes/Microbiome-new/2010-1-28: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Sam Chiang
>Sam Chiang
 
(6 intermediate revisions by the same user not shown)
Line 1: Line 1:
='''16S LD-PCR 40cycle amplification for Sanger sequencing'''=
='''16S LD-PCR 40cycle amplification for bacteria genotyping'''=


==Backgorund==
==Backgorund==
Line 7: Line 7:
==Procedure==
==Procedure==
  Taq-Gold(ABI) recipe
  Taq-Gold(ABI) recipe
                        1rxn      4+1rxn   
                            1rxn      4+1rxn   
  -----------------------------------------
  ---------------------------------------------
  H2O                   13.5        67.5
  H2O                         13.5        67.5
  10X buf               2.0        10.0
  10X buf                     2.0        10.0
  MgCl2                 2.0        10.0
  MgCl2                       2.0        10.0
  Primer(10uM)           1.0        5.0 - Microseq_16S  
  Micro Seq primer(f+r,10uM)   1.0        5.0 - Microseq_16S  
  dNTP(10mM)             0.4        2.0
  dNTP(10mM)                   0.4        2.0
  Taq-Gold Enzyme       0.1        0.5
  Taq-Gold Enzyme             0.1        0.5
  --------------------------------------
  ---------------------------------------------
                      19.0        95.0    95/5=19  template-1uL  
                            19.0        95.0    95/5=19  template-1uL  
   
   
  '''Template (1uL): 11-1, 11-2, 12-1, 12-2'''
  '''Template (1uL): 11-1, 11-2, 12-1, 12-2'''
  11-1, 12-1: 1uL eliqote from 20uL size selected 1st PCR amplicons
  11-1, 12-1: 1uL eliqote from 20uL (E-gel) size selected 1st PCR amplicons
  11-2, 12-2: 1uL eliqote from 1st PCR amplicons
  11-2, 12-2: 1uL eliqote from 1st PCR amplicons
   
   
Line 33: Line 33:
*'''The E-gel size selected templates (11-1 and 12-1) showed higer specificity than direct-eliqote template from 1st PCR amplicons (11-2, 12-2)'''
*'''The E-gel size selected templates (11-1 and 12-1) showed higer specificity than direct-eliqote template from 1st PCR amplicons (11-2, 12-2)'''
*I only use 2nd PCR amplcons from 11-1 and 12-1 for Sanger sequencing.
*I only use 2nd PCR amplcons from 11-1 and 12-1 for Sanger sequencing.
 
*I purifified the 2nd PCR product(20uL) with Montage filter and sent to Genewiz for sequecing.
==PCR product purification with Montage PCR filter==
*Mix 20uL PCR prodcut with 380uL 1XTE buffer (400uL volume in total). Mix well by vortexing 5sec.
*Assemble the Montage filter on collecting tube.
*Transfer the mixture onto a assembled filter.
*Centrifuge the filter at 1000xg, for 15min at RT.
*After centrifuge, revese the filter and put on a fresh collecting tubes carefully.
*Centrifuge the filter at 1000xg. for 2 min to retrieve the purified PCR products.
**'''The concentration purified PCR products were about ~40ng/uL in 20uL (by Nanodrop, blanked with 1X TE)'''
 
==Sample dilution for Sanger sequencing at GeneWiz==
*Concentration requirement for '''pre-mixed sample'''
**Total volume 15uL
**PCR product: 20ng ~ 40ng in 10uL
**Primer:      25pmole in 5uL
 
*Dilution procedures
**Step1: Mix 1uL un-diluted PCR product (~40ng/uL) with 9uL 1X TE -> 40ng of template in 10uL
**Step2: Mix 1uL original 16S-microseq primer-f (100uM) with 19uL H2O -> 5uM, get 5uL of diluted primer (-> 25pmole)
**Mix the solution from Step1 and step2 -> 15uL, transfer into a 8-well stripe tube. Label the sampe on the tubes.


==Sequence results==
==Sequence results==
*I got very high quality score (49 and 50) for both samples.
*I got very high quality scores (49 and 50) for both samples.
*'''For both sequence, the blast (NCBI nt database) results hit uncultureable bacterium'''   
*'''For both sequence, the blast (NCBI nt database) results hit unculturable bacterium'''   


  Sequence File : 11-1-sam012810-16S.seq
  Sequence File : 11-1-sam012810-16S.seq

Latest revision as of 18:50, 25 May 2010

16S LD-PCR 40cycle amplification for bacteria genotyping[edit]

Backgorund[edit]

  • I identified two possible positive amplicons by 16S-LD PCR validation. However the PCR products concentration might be too low for sequencing.
  • By doing Size selection + 2nd PCR amplification, I can get enough specific PCR product for sequencing.

Procedure[edit]

Taq-Gold(ABI) recipe
                            1rxn       4+1rxn  
---------------------------------------------
H2O                         13.5        67.5
10X buf                      2.0        10.0
MgCl2                        2.0        10.0
Micro Seq primer(f+r,10uM)   1.0         5.0 - Microseq_16S 
dNTP(10mM)                   0.4         2.0
Taq-Gold Enzyme              0.1         0.5
---------------------------------------------
                            19.0        95.0    95/5=19   template-1uL 

Template (1uL): 11-1, 11-2, 12-1, 12-2
11-1, 12-1: 1uL eliqote from 20uL (E-gel) size selected 1st PCR amplicons
11-2, 12-2: 1uL eliqote from 1st PCR amplicons

Program "16S-amp (40cycle)

Results[edit]

  • 1uL 2nd-PCR amplicons were varified by 2% agarose gel
    • Sample well: 1uL sample + 5uL 0.5X TBE + 2uL 6X loading dye
    • Ladder: 5uL pre-diluted 1kb-plus ladder
File:Sam012810-2nd PCR.jpg
  • The E-gel size selected templates (11-1 and 12-1) showed higer specificity than direct-eliqote template from 1st PCR amplicons (11-2, 12-2)
  • I only use 2nd PCR amplcons from 11-1 and 12-1 for Sanger sequencing.
  • I purifified the 2nd PCR product(20uL) with Montage filter and sent to Genewiz for sequecing.

Sequence results[edit]

  • I got very high quality scores (49 and 50) for both samples.
  • For both sequence, the blast (NCBI nt database) results hit unculturable bacterium
Sequence File : 11-1-sam012810-16S.seq

>11-1-sam012810-16S_A09.ab1
CNNNNANNNNNGNCGNGGNATGATGCNATTTGAACGGACCTTTTTTGNAATAACCCTTCTGGTGGAAATTAGGAAAGGTT
AGTGGCAGACGGGGGAGTAACGCGTAGAAAATCTACCTTAAAGACTGGGACAACAGTTGGAAACGACTGCTAATACCGGA
TACGCTGCACATAGGGCATCCTAGGTGCAGGAAAAGAGGCCTCTTAACAATGCTCCTGCTTTTAGATGAGTCTGCGTCTG
ATTAGCTAGATGGTGGGGTAACGGCTTACCATGGCGACGATCAGTAGTCGGCCTGAGAGGGTGACCGGCCACATTGGGAC
TGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCG
CGTGATCGAATGAAGGCCTTCGGGTTGTAAAGATCTGTTGACAGGGACGAATAAGCAATGCGAATAGTTTTGTGTATGAC
GGTACCTGTTTAGAAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTAA


Sequence File : 12-1-sam012810-16S.seq

>12-1-sam012810-16S_B09.ab1
CNNNNANNNNGGCGNNGTATGATGCTATTTGAGGGGCATCAACTTATGGTGGCTGGGGCTGGTGACCGGACGACGTTTGC
GGAAACCGTACGNACCTTCCTTGGTAAGGGGGATAGCCCATAGAAATGTGGATTAATACCCCGTAAGATAGTGGGATGGC
ATCATACTACTATTATAGTTACGACGCTTGAAGATGGGTGTGCGTCTGATTAGGTAGTTGGCGGGGTAAAGGCCCACCAA
GCCTTCGATCAGTAGCTGATGTGAGAGCATGATCAGCCACACGGGCACTGAGACACGGGCCCGACTCCTACGGGAGGCAG
CAGTAAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCATGCCGCGTGAAGGATGAAGGTCCTCTGGATTGTAAAC
TTCTTTTATAGGGGGCGAAAAAAGGGAAATCTTTCTCACTTGACAGTACCCTATGAATAAGCACCGGCTAACTCCGTGCC
AGCAGCCGCGGTAA