Alice:LabNotes/2010-3-8: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Zsakura2
>Zsakura2
 
(8 intermediate revisions by the same user not shown)
Line 205: Line 205:
|}
|}


**<font color=red>NOTE The primer design above is NOT accurate! The DNA sequence above were taken from assembly Feb. 2009 (GRCh37/hg19), however, the probe design used assembly Mar. 2006 (NCBI36/hg18). Therefore, these primers will be need to be redesigned! </font>
*<font color=red>NOTE: The primer design above is NOT accurate! The DNA sequence above were taken from assembly Feb. 2009 (GRCh37/hg19), however, the probe design used assembly Mar. 2006 (NCBI36/hg18). Therefore, these primers will be need to be redesigned! </font>


#Dilute the NSC assay forward and reverse primers to 2μM.
#Dilute the NSC assay forward and reverse primers to 2μM.
Line 220: Line 220:
===results===
===results===
{| {{table}}
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Well / Set'''
| align="center" style="background:#f0f0f0;"|'''Dye'''
| align="center" style="background:#f0f0f0;"|'''Content'''
| align="center" style="background:#f0f0f0;"|'''sample ID'''
| align="center" style="background:#f0f0f0;"|'''sample ID'''
| align="center" style="background:#f0f0f0;"|'''Efficiency'''
| align="center" style="background:#f0f0f0;"|'''efficiency'''
| align="center" style="background:#f0f0f0;"|'''C(t)'''
| align="center" style="background:#f0f0f0;"|'''C(t)'''
| align="center" style="background:#f0f0f0;"|'''d=sample C(t) gDNA C(t)'''
| align="center" style="background:#f0f0f0;"|'''d=sample C(t) -gDNA C(t)'''
| align="center" style="background:#f0f0f0;"|'''enrichment ratio (2^d)'''
| align="center" style="background:#f0f0f0;"|'''enrichment ratio = 1/ 2^d'''
| align="center" style="background:#f0f0f0;"|'''mean'''
| align="center" style="background:#f0f0f0;"|'''mean'''
| align="center" style="background:#f0f0f0;"|''''''
|-
|-
| ||||||||||||||||||||||||||||||
| DF-no wash-Chr11||N/A||N/A||||||||
|-
|-
| ||||||||||||||||||||||||||||||
| DF-no wash-Chr11||N/A||N/A||||||||
|-
|-
| A1||SBG1||Sample||DF-no wash-Chr11||N/A||N/A||||||||||||||||||||
| DF-no wash-Chr7||26.11%||30.45|| align="center" style="background:#f0f0f0;"|2.36||0.19||0.16||
|-
|-
| A2||SBG1||Sample||DF-no wash-Chr11||N/A||N/A||||||||||||||||||||
| DF-no wash-Chr7||22.00%||31.34|| align="center" style="background:#f0f0f0;"|3.09||0.12||||
|-
|-
| A3||SBG1||Sample||DF-no wash-Chr7||26.11%||30.45||2.36||5.13||6.82||||||||||||||
| DF-no wash-Chr5||N/A||N/A||||||||
|-
|-
| A4||SBG1||Sample||DF-no wash-Chr7||22.00%||31.34||3.09||8.51||||||||||||||||
| DF-no wash-Chr5||N/A||N/A||||||||
|-
|-
| A5||SBG1||Sample||DF-no wash-Chr5||N/A||N/A||||||||||||||||||||
| DF set2-no wash-Chr11||N/A||N/A||||||||
|-
|-
| A6||SBG1||Sample||DF-no wash-Chr5||N/A||N/A||||||||||||||||||||
| DF set2-no wash-Chr11||N/A||N/A||||||||
|-
|-
| B1||SBG1||Sample||DF set2-no wash-Chr11||N/A||N/A||||||||||||||||||||
| DF set2-no wash-Chr7||25.07%||30.43|| align="center" style="background:#f0f0f0;"|2.34||0.2||0.17||
|-
|-
| B2||SBG1||Sample||DF set2-no wash-Chr11||N/A||N/A||||||||||||||||||||
| DF set2-no wash-Chr7||26.02%||30.97|| align="center" style="background:#f0f0f0;"|2.72||0.15||||
|-
|-
| B3||SBG1||Sample||DF set2-no wash-Chr7||25.07%||30.43||2.34||5.06||5.83||||||||||||||
| DF set2-no wash-Chr5||N/A||N/A||||||||
|-
|-
| B4||SBG1||Sample||DF set2-no wash-Chr7||26.02%||30.97||2.72||6.59||||||||||||||||
| DF set2-no wash-Chr5||N/A||N/A||||||||
|-
|-
| B5||SBG1||Sample||DF set2-no wash-Chr5||N/A||N/A||||||||||||||||||||
| DF-45C wash-Chr11||N/A||N/A||||||||
|-
|-
| B6||SBG1||Sample||DF set2-no wash-Chr5||N/A||N/A||||||||||||||||||||
| DF-45C wash-Chr11||N/A||N/A||||||||
|-
|-
| C1||SBG1||Sample||DF-45C wash-Chr11||N/A||N/A||||||||||||||||||||
| DF-45C wash-Chr7||25.28%||29.96|| align="center" style="background:#f0f0f0;"|1.87||0.27||0.33||
|-
|-
| C2||SBG1||Sample||DF-45C wash-Chr11||N/A||N/A||||||||||||||||||||
| DF-45C wash-Chr7||24.78%||29.64|| align="center" style="background:#f0f0f0;"|1.39||0.38||||
|-
|-
| C3||SBG1||Sample||DF-45C wash-Chr7||25.28%||29.96||1.87||3.66||3.14||||||||||||||
| DF-45C wash-Chr5||N/A||N/A||||||||
|-
|-
| C4||SBG1||Sample||DF-45C wash-Chr7||24.78%||29.64||1.39||2.62||||||||||||||||
| DF-45C wash-Chr5||N/A||N/A||||||||
|-
|-
| C5||SBG1||Sample||DF-45C wash-Chr5||N/A||N/A||||||||||||||||||||
| DF set2-45C wash-Chr11||N/A||N/A||||||||
|-
|-
| C6||SBG1||Sample||DF-45C wash-Chr5||N/A||N/A||||||||||||||||||||
| DF set2-45C wash-Chr11||N/A||N/A||||||||
|-
|-
| D1||SBG1||Sample||DF set2-45C wash-Chr11||N/A||N/A||||||||||||||||||||
| DF set2-45C wash-Chr7||N/A||N/A||||||||
|-
|-
| D2||SBG1||Sample||DF set2-45C wash-Chr11||N/A||N/A||||||||||||||||||||
| DF set2-45C wash-Chr7||N/A||N/A||||||||
|-
|-
| D3||SBG1||Sample||DF set2-45C wash-Chr7||N/A||N/A||||||||||||||||||||
| DF set2-45C wash-Chr5||N/A||N/A||||||||
|-
|-
| D4||SBG1||Sample||DF set2-45C wash-Chr7||N/A||N/A||||||||||||||||||||
| DF set2-45C wash-Chr5||N/A||N/A||||||||
|-
|-
| D5||SBG1||Sample||DF set2-45C wash-Chr5||N/A||N/A||||||||||||||||||||
| foreskin-no wash-chr 11||N/A||N/A||||||||
|-
|-
| D6||SBG1||Sample||DF set2-45C wash-Chr5||N/A||N/A||||||||||||||||||||
| foreskin-no wash-chr 11||N/A||N/A||||||||
|-
|-
| E1||SBG1||Sample||foreskin-no wash-chr 11||N/A||N/A||||||||||||||||||||
| foreskin-no wash-chr 7||31.87%||29.35|| align="center" style="background:#f0f0f0;"|1.26||0.42||0.3||
|-
|-
| E2||SBG1||Sample||foreskin-no wash-chr 11||N/A||N/A||||||||||||||||||||
| foreskin-no wash-chr 7||27.05%||30.75|| align="center" style="background:#f0f0f0;"|2.5||0.18||||
|-
|-
| E3||SBG1||Sample||foreskin-no wash-chr 7||31.87%||29.35||1.26||2.39||4.03||||||||||||||
| foreskin-no wash-chr 5||N/A||N/A||||||||
|-
|-
| E4||SBG1||Sample||foreskin-no wash-chr 7||27.05%||30.75||2.5||5.66||||||||||||||||
| foreskin-no wash-chr 5||N/A||N/A||||||||
|-
|-
| E5||SBG1||Sample||foreskin-no wash-chr 5||N/A||N/A||||||||||||||||||||
| DF-gDNA-chr11||N/A||N/A||||||||
|-
|-
| E6||SBG1||Sample||foreskin-no wash-chr 5||N/A||N/A||||||||||||||||||||
| DF-gDNA-chr11||N/A||N/A||||||||
|-
|-
| F1||SBG1||Standard||DF-gDNA-chr11||N/A||N/A||||||||||||||||||||
| DF-gDNA-chr7||18.21%||28.09||||||||
|-
|-
| F2||SBG1||Standard||DF-gDNA-chr11||N/A||N/A||||||||||||||||||||
| DF-gDNA-chr7||19.17%||28.25||||||||
|-
|-
| F3||SBG1||Standard||DF-gDNA-chr7||18.21%||28.09||||||||||||||||||||
| DF-gDNA-chr5||N/A||N/A||||||||
|-
|-
| F4||SBG1||Standard||DF-gDNA-chr7||19.17%||28.25||||||||||||||||||||
| DF-gDNA-chr5||N/A||N/A||||||||
|-
| F5||SBG1||Standard||DF-gDNA-chr5||N/A||N/A||||||||||||||||||||
|-
| F6||SBG1||Standard||DF-gDNA-chr5||N/A||N/A||||||||||||||||||||
|-
|  
|}
|}


===conclusion===
===conclusion===
*It seems like we were able to capture regions covered on chr7, and got enrichment level that is 2 to 8 fold less than the gDNA across different samples.
*It seems like we were able to capture regions covered on chr7, however, we didn't get any enrichment on these regions.


*For DF set2 with 45C wash, I didn't get good amount of amplification during the last PCR step, I would think this is somewhat related to the low/zero enrichment level we seen in the graph. However, this is inconsistent with our previous results. Actually, in last enrichment analysis PCR, I found a mistake. I used SYBR green along with Kapa master mix. Kapa already included SYBR green, therefore adding extra SYBR green should be problematic (high concentration causes inhibition), thus the results from last time wasn't too trustworthy.
*For DF set2 with 45C wash, I didn't get good amount of amplification during the last PCR step, I would think this is somewhat related to the low/zero enrichment level we seen in the graph. However, this is inconsistent with our previous results. Actually, in last enrichment analysis PCR, I found a mistake. I used SYBR green along with Kapa master mix. Kapa already included SYBR green, therefore adding extra SYBR green should be problematic (high concentration causes inhibition), thus the results from last time wasn't too trustworthy.
Line 326: Line 318:
===results===
===results===
{| {{table}}
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Well / Set'''
| align="center" style="background:#f0f0f0;"|'''Content'''
| align="center" style="background:#f0f0f0;"|'''sample ID'''
| align="center" style="background:#f0f0f0;"|'''sample ID'''
| align="center" style="background:#f0f0f0;"|'''Efficiency'''
| align="center" style="background:#f0f0f0;"|'''Efficiency'''
| align="center" style="background:#f0f0f0;"|'''C(t)'''
| align="center" style="background:#f0f0f0;"|'''C(t)'''
| align="center" style="background:#f0f0f0;"|'''d1=Sample C(t) – gDNA C(t)'''
| align="center" style="background:#f0f0f0;"|'''d1=Sample C(t) – gDNA C(t)'''
| align="center" style="background:#f0f0f0;"|'''enrichment ratio (2^d1)'''
| align="center" style="background:#f0f0f0;"|'''enrichment ratio: 1/2^d'''
| align="center" style="background:#f0f0f0;"|'''mean'''
| align="center" style="background:#f0f0f0;"|'''mean'''
| align="center" style="background:#f0f0f0;"|'''median'''
| align="center" style="background:#f0f0f0;"|'''median'''
| align="center" style="background:#f0f0f0;"|'''d2=sample C(t) – Nimblegen data C(t)'''
| align="center" style="background:#f0f0f0;"|'''d2=sample C(t) – Nimblegen data C(t)'''
| align="center" style="background:#f0f0f0;"|'''enrichment ratio (2^d2)'''
| align="center" style="background:#f0f0f0;"|'''enrichment ratio: 1/2^d2'''
| align="center" style="background:#f0f0f0;"|'''mean'''
| align="center" style="background:#f0f0f0;"|'''mean'''
| align="center" style="background:#f0f0f0;"|'''median'''
| align="center" style="background:#f0f0f0;"|'''median'''
|-
|-
| ||||||||||||||||||||||||
| DF-no wash-Chr11||34.84%||28.27||3.92||0.07||0.13||0.1||8.67||0.00246||0.22||0
|-
| ||||||||||||||||||||||||
|-
| A1||Sample||DF-no wash-Chr11||34.84%||28.27||3.92||15.14||16.7||9.63||8.67||407.31||3877.94||2603.91
|-
| A2||Sample||DF-no wash-Chr11||33.29%||28.14||3.35||10.2||||||8.17||288.01||||
|-
| A3||Sample||DF-no wash-Chr7||42.42%||26.18||3.76||13.55||||||-0.92||0.53||||
|-
| A4||Sample||DF-no wash-Chr7||52.80%||25.93||3.34||10.13||||||0.35||1.27||||
|-
| A5||Sample||DF-no wash-NSC 237||44.30%||27.89||3.18||9.06||||||11.28||2486.67||||
|-
| A6||Sample||DF-no wash-NSC 237||37.19%||28.69||2.42||5.35||||||12.65||6427.31||||
|-
| A7||Sample||DF-no wash-NSC 268||44.07%||26.56||2.75||6.73||||||11.41||2721.15||||
|-
| A8||Sample||DF-no wash-NSC 268||46.93%||26.55||1.84||3.58||||||11.76||3468.27||||
|-
| A9||Sample||DF-no wash-NSC 247||19.11%||28.86||5||32||||||13.05||8480.89||||
|-
| A10||Sample||DF-no wash-NSC 247||17.82%||30.36||6.36||82.14||||||14.05||16961.78||||
|-
| A11||Sample||DF-no wash-NSC 272||27.54%||29.12||3.19||9.13||||||11.74||3420.52||||
|-
| A12||Sample||DF-no wash-NSC 272||35.59%||28.58||1.79||3.46||||||10.87||1871.53||||
|-
| B1||Sample||DF set2-no wash-Chr11||34.16%||28.03||3.68||12.82||6.42||5.15||8.43||344.89||1561.74||907.21
|-
| B2||Sample||DF set2-no wash-Chr11||40.07%||27.99||3.2||9.19||||||8.02||259.57||||
|-
|-
| B3||Sample||DF set2-no wash-Chr7||50.85%||25.66||3.24||9.45||||||-1.44||0.37||||
| DF-no wash-Chr11||33.29%||28.14||3.35||0.1||||||8.17||0.00347||||
|-
|-
| B4||Sample||DF set2-no wash-Chr7||40.60%||26||3.41||10.63||||||0.42||1.34||||
| DF-no wash-Chr7||42.42%||26.18||3.76||0.07||||||-0.92||1.89212||||
|-
|-
| B5||Sample||DF set2-no wash-NSC 237||37.64%||28.21||3.5||11.31||||||11.6||3104.19||||
| DF-no wash-Chr7||52.80%||25.93||3.34||0.1||||||0.35||0.78458||||
|-
|-
| B6||Sample||DF set2-no wash-NSC 237||40.56%||28.68||2.41||5.31||||||12.64||6382.92||||
| DF-no wash-NSC 237||44.30%||27.89||3.18||0.11||||||11.28||0.00040||||
|-
|-
| B7||Sample||DF set2-no wash-NSC 268||42.94%||26.13||2.32||4.99||||||10.98||2019.8||||
| DF-no wash-NSC 237||37.19%||28.69||2.42||0.19||||||12.65||0.00016||||
|-
|-
| B8||Sample||DF set2-no wash-NSC 268||42.47%||26.31||1.6||3.03||||||11.52||2936.74||||
| DF-no wash-NSC 268||44.07%||26.56||2.75||0.15||||||11.41||0.00037||||
|-
|-
| B9||Sample||DF set2-no wash-NSC 247||44.94%||24.9||1.04||2.06||||||9.09||544.96||||
| DF-no wash-NSC 268||46.93%||26.55||1.84||0.28||||||11.76||0.00029||||
|-
|-
| B10||Sample||DF set2-no wash-NSC 247||35.02%||25.15||1.15||2.22||||||8.84||458.25||||
| DF-no wash-NSC 247||19.11%||28.86||5||0.03||||||13.05||0.00012||||
|-
|-
| B11||Sample||DF set2-no wash-NSC 272||44.63%||27.69||1.76||3.39||||||10.31||1269.46||||
| DF-no wash-NSC 247||17.82%||30.36||6.36||0.01||||||14.05||0.00006||||
|-
|-
| B12||Sample||DF set2-no wash-NSC 272||34.67%||28.18||1.39||2.62||||||10.47||1418.35||||
| DF-no wash-NSC 272||27.54%||29.12||3.19||0.11||||||11.74||0.00029||||
|-
|-
| C1||Sample||DF-45C wash-Chr11||34.35%||28.12||3.77||13.64||7.25||6.01||8.52||367.09||2058.92||1913.41
| DF-no wash-NSC 272||35.59%||28.58||1.79||0.29||||||10.87||0.00053||||
|-
|-
| C2||Sample||DF-45C wash-Chr11||33.56%||28.31||3.52||11.47||||||8.34||324.03||||
| DF set2-no wash-Chr11||34.16%||28.03||3.68||0.08||0.23||0.19||8.43||0.00290||0.29||0
|-
|-
| C3||Sample||DF-45C wash-Chr7||38.31%||25.09||2.67||6.36||||||-2.01||0.25||||
| DF set2-no wash-Chr11||40.07%||27.99||3.2||0.11||||||8.02||0.00385||||
|-
|-
| C4||Sample||DF-45C wash-Chr7||49.62%||24.74||2.15||4.44||||||-0.84||0.56||||
| DF set2-no wash-Chr7||50.85%||25.66||3.24||0.11||||||-1.44||2.71321||||
|-
|-
| C5||Sample||DF-45C wash-NSC 237||39.28%||28.27||3.56||11.79||||||11.66||3236.01||||
| DF set2-no wash-Chr7||40.60%||26||3.41||0.09||||||0.42||0.74742||||
|-
|-
| C6||Sample||DF-45C wash-NSC 237||39.49%||28.23||1.96||3.89||||||12.19||4672.57||||
| DF set2-no wash-NSC 237||37.64%||28.21||3.5||0.09||||||11.6||0.00032||||
|-
|-
| C7||Sample||DF-45C wash-NSC 268||49.68%||26.87||3.06||8.34||||||11.72||3373.43||||
| DF set2-no wash-NSC 237||40.56%||28.68||2.41||0.19||||||12.64||0.00016||||
|-
|-
| C8||Sample||DF-45C wash-NSC 268||51.21%||26.8||2.09||4.26||||||12.01||4124.49||||
| DF set2-no wash-NSC 268||42.94%||26.13||2.32||0.2||||||10.98||0.00050||||
|-
|-
| C9||Sample||DF-45C wash-NSC 247||40.09%||25.39||1.53||2.89||||||9.58||765.36||||
| DF set2-no wash-NSC 268||42.47%||26.31||1.6||0.33||||||11.52||0.00034||||
|-
|-
| C10||Sample||DF-45C wash-NSC 247||40.44%||25.79||1.79||3.46||||||9.48||714.11||||
| DF set2-no wash-NSC 247||44.94%||24.9||1.04||0.49||||||9.09||0.00184||||
|-
|-
| C11||Sample||DF-45C wash-NSC 272||38.29%||29.37||3.44||10.85||||||11.99||4067.71||||
| DF set2-no wash-NSC 247||35.02%||25.15||1.15||0.45||||||8.84||0.00218||||
|-
|-
| C12||Sample||DF-45C wash-NSC 272||38.71%||29.29||2.5||5.66||||||11.58||3061.45||||
| DF set2-no wash-NSC 272||44.63%||27.69||1.76||0.3||||||10.31||0.00079||||
|-
|-
| ||||||||||||||||||||||||
| DF set2-no wash-NSC 272||34.67%||28.18||1.39||0.38||||||10.47||0.00071||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-Chr11||34.35%||28.12||3.77||0.07||0.18||0.17||8.52||0.00272||0.49||0
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-Chr11||33.56%||28.31||3.52||0.09||||||8.34||0.00309||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-Chr7||38.31%||25.09||2.67||0.16||||||-2.01||4.02782||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-Chr7||49.62%||24.74||2.15||0.23||||||-0.84||1.79005||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-NSC 237||39.28%||28.27||3.56||0.08||||||11.66||0.00031||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-NSC 237||39.49%||28.23||1.96||0.26||||||12.19||0.00021||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-NSC 268||49.68%||26.87||3.06||0.12||||||11.72||0.00030||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-NSC 268||51.21%||26.8||2.09||0.23||||||12.01||0.00024||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-NSC 247||40.09%||25.39||1.53||0.35||||||9.58||0.00131||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-NSC 247||40.44%||25.79||1.79||0.29||||||9.48||0.00140||||
|-
|-
| ||||||||||||||||||||||||
| DF-45C wash-NSC 272||38.29%||29.37||3.44||0.09||||||11.99||0.00025||||
|-
|-
| E1||Sample||foreskin-no wash-chr 10||43.11%||26.85||2.5||5.66||4.64||4.68||||||||
| DF-45C wash-NSC 272||38.71%||29.29||2.5||0.18||||||11.58||0.00033||||
|-
|-
| E2||Sample||foreskin-no wash-chr 10||41.44%||26.97||2.18||4.53||||||||||||
| foreskin-no wash-chr 10||43.11%||26.85||2.5||0.18||0.29||0.21||||||||
|-
|-
| E3||Sample||foreskin-no wash-chr 7||48.40%||25.36||2.94||7.67||||||||||||
| foreskin-no wash-chr 10||41.44%||26.97||2.18||0.22||||||||||||
|-
|-
| E4||Sample||foreskin-no wash-chr 7||48.11%||25.59||3||8||||||||||||
| foreskin-no wash-chr 7||48.40%||25.36||2.94||0.13||||||||||||
|-
|-
| E5||Sample||foreskin-no wash-NSC 237||45.61%||27.89||3.18||9.06||||||||||||
| foreskin-no wash-chr 7||48.11%||25.59||3||0.13||||||||||||
|-
|-
| E6||Sample||foreskin-no wash-NSC 237||36.37%||28.6||2.33||5.03||||||||||||
| foreskin-no wash-NSC 237||45.61%||27.89||3.18||0.11||||||||||||
|-
|-
| E7||Sample||foreskin-no wash-NSC 268||40.52%||26.08||2.27||4.82||||||||||||
| foreskin-no wash-NSC 237||36.37%||28.6||2.33||0.2||||||||||||
|-
|-
| E8||Sample||foreskin-no wash-NSC 268||41.44%||26.2||1.49||2.81||||||||||||
| foreskin-no wash-NSC 268||40.52%||26.08||2.27||0.21||||||||||||
|-
|-
| E9||Sample||foreskin-no wash-NSC 247||45.23%||24.67||0.81||1.75||||||||||||
| foreskin-no wash-NSC 268||41.44%||26.2||1.49||0.36||||||||||||
|-
|-
| E10||Sample||foreskin-no wash-NSC 247||37.46%||25.16||1.16||2.23||||||||||||
| foreskin-no wash-NSC 247||45.23%||24.67||0.81||0.57||||||||||||
|-
|-
| E11||Sample||foreskin-no wash-NSC 272||43.49%||27.15||1.22||2.33||||||||||||
| foreskin-no wash-NSC 247||37.46%||25.16||1.16||0.45||||||||||||
|-
|-
| E12||Sample||foreskin-no wash-NSC 272||41.18%||27.64||0.85||1.8||||||||||||
| foreskin-no wash-NSC 272||43.49%||27.15||1.22||0.43||||||||||||
|-
|-
| F1||Sample||foreskin-45C-chr 10||40.86%||26.6||2.25||4.76||7.23||6.68||||||||
| foreskin-no wash-NSC 272||41.18%||27.64||0.85||0.55||||||||||||
|-
|-
| F2||Sample||foreskin-45C-chr 10||41.86%||26.66||1.87||3.66||||||||||||
| foreskin-45C-chr 10||40.86%||26.6||2.25||0.21||0.17||0.15||||||||
|-
|-
| F3||Sample||foreskin-45C-chr 7||44.72%||25.26||2.84||7.16||||||||||||
| foreskin-45C-chr 10||41.86%||26.66||1.87||0.27||||||||||||
|-
|-
| F4||Sample||foreskin-45C-chr 7||44.65%||25.2||2.61||6.11||||||||||||
| foreskin-45C-chr 7||44.72%||25.26||2.84||0.14||||||||||||
|-
|-
| F5||Sample||foreskin-45C-NSC 237||43.36%||28.64||3.93||15.24||||||||||||
| foreskin-45C-chr 7||44.65%||25.2||2.61||0.16||||||||||||
|-
|-
| F6||Sample||foreskin-45C-NSC 237||33.89%||29.73||3.46||11||||||||||||
| foreskin-45C-NSC 237||43.36%||28.64||3.93||0.07||||||||||||
|-
|-
| F7||Sample||foreskin-45C-NSC 268||49.90%||25.96||2.15||4.44||||||||||||
| foreskin-45C-NSC 237||33.89%||29.73||3.46||0.09||||||||||||
|-
|-
| F8||Sample||foreskin-45C-NSC 268||41.19%||26.18||1.47||2.77||||||||||||
| foreskin-45C-NSC 268||49.90%||25.96||2.15||0.23||||||||||||
|-
|-
| F9||Sample||foreskin-45C-NSC 247||43.75%||26.49||2.63||6.19||||||||||||
| foreskin-45C-NSC 268||41.19%||26.18||1.47||0.36||||||||||||
|-
|-
| F10||Sample||foreskin-45C-NSC 247||35.44%||27.08||3.08||8.46||||||||||||
| foreskin-45C-NSC 247||43.75%||26.49||2.63||0.16||||||||||||
|-
|-
| F11||Sample||foreskin-45C-NSC 272||44.04%||29.03||3.1||8.57||||||||||||
| foreskin-45C-NSC 247||35.44%||27.08||3.08||0.12||||||||||||
|-
|-
| F12||Sample||foreskin-45C-NSC 272||43.25%||29.86||3.07||8.4||||||||||||
| foreskin-45C-NSC 272||44.04%||29.03||3.1||0.12||||||||||||
|-
|-
| G1||Standard||foreskin-gDNA-chr10||27.51%||24.35||||||||||||||||
| foreskin-45C-NSC 272||43.25%||29.86||3.07||0.12||||||||||||
|-
|-
| G2||Standard||foreskin-gDNA-chr10||29.77%||24.79||||||||||||||||
| foreskin-gDNA-chr10||27.51%||24.35||||||||||||||||
|-
|-
| G3||Standard||foreskin-gDNA-chr7||36.64%||22.42||||||||||||||||
| foreskin-gDNA-chr10||29.77%||24.79||||||||||||||||
|-
|-
| G4||Standard||foreskin-gDNA-chr7||38.12%||22.59||||||||||||||||
| foreskin-gDNA-chr7||36.64%||22.42||||||||||||||||
|-
|-
| G5||Standard||foreskin-gDNA-NSC 237||33.36%||24.71||||||||||||||||
| foreskin-gDNA-chr7||38.12%||22.59||||||||||||||||
|-
|-
| G6||Standard||foreskin-gDNA-NSC 237||24.24%||26.27||||||||||||||||
| foreskin-gDNA-NSC 237||33.36%||24.71||||||||||||||||
|-
|-
| G7||Standard||foreskin-gDNA-NSC 268||37.41%||23.81||||||||||||||||
| foreskin-gDNA-NSC 237||24.24%||26.27||||||||||||||||
|-
|-
| G8||Standard||foreskin-gDNA-NSC 268||28.89%||24.71||||||||||||||||
| foreskin-gDNA-NSC 268||37.41%||23.81||||||||||||||||
|-
|-
| G9||Standard||foreskin-gDNA-NSC 247||34.97%||23.86||||||||||||||||
| foreskin-gDNA-NSC 268||28.89%||24.71||||||||||||||||
|-
|-
| G10||Standard||foreskin-gDNA-NSC 247||27.15%||24||||||||||||||||
| foreskin-gDNA-NSC 247||34.97%||23.86||||||||||||||||
|-
|-
| G11||Standard||foreskin-gDNA-NSC 272||37.33%||25.93||||||||||||||||
| foreskin-gDNA-NSC 247||27.15%||24||||||||||||||||
|-
|-
| G12||Standard||foreskin-gDNA-NSC 272||30.36%||26.79||||||||||||||||
| foreskin-gDNA-NSC 272||37.33%||25.93||||||||||||||||
|-
|-
| H1||Sample||DF-nimblegen-chr10||37.15%||19.6||||||||||||||||
| foreskin-gDNA-NSC 272||30.36%||26.79||||||||||||||||
|-
|-
| H2||Sample||DF-nimblegen-chr10||39.72%||19.97||||||||||||||||
| DF-nimblegen-chr10||37.15%||19.6||||||||||||||||
|-
|-
| H3||Sample||DF-nimblegen-chr7||23.10%||27.1||||||||||||||||
| DF-nimblegen-chr10||39.72%||19.97||||||||||||||||
|-
|-
| H4||Sample||DF-nimblegen-chr7||34.14%||25.58||||||||||||||||
| DF-nimblegen-chr7||23.10%||27.1||||||||||||||||
|-
|-
| H5||Sample||DF-nimblegen-NSC 237||39.28%||16.61||||||||||||||||
| DF-nimblegen-chr7||34.14%||25.58||||||||||||||||
|-
|-
| H6||Sample||DF-nimblegen-NSC 237||33.44%||16.04||||||||||||||||
| DF-nimblegen-NSC 237||39.28%||16.61||||||||||||||||
|-
|-
| H7||Sample||DF-nimblegen-NSC 268||35.90%||15.15||||||||||||||||
| DF-nimblegen-NSC 237||33.44%||16.04||||||||||||||||
|-
|-
| H8||Sample||DF-nimblegen-NSC 268||41.22%||14.79||||||||||||||||
| DF-nimblegen-NSC 268||35.90%||15.15||||||||||||||||
|-
|-
| H9||Sample||DF-nimblegen-NSC 247||41.80%||15.81||||||||||||||||
| DF-nimblegen-NSC 268||41.22%||14.79||||||||||||||||
|-
|-
| H10||Sample||DF-nimblegen-NSC 247||34.62%||16.31||||||||||||||||
| DF-nimblegen-NSC 247||41.80%||15.81||||||||||||||||
|-
|-
| H11||Sample||DF-nimblegen-NSC 272||37.82%||17.38||||||||||||||||
| DF-nimblegen-NSC 247||34.62%||16.31||||||||||||||||
|-
|-
| H12||Sample||DF-nimblegen-NSC 272||38.79%||17.71||||||||||||||||
| DF-nimblegen-NSC 272||37.82%||17.38||||||||||||||||
|-
|-
|  
| DF-nimblegen-NSC 272||38.79%||17.71||||||||||||||||
|}
|}


===conclusion===
===conclusion===
*From the above results, we can conclude that commercialized Nimblegen kits definitely had the best enrichment level out of all.
*From the above results, we can conclude that commercialized Nimblegen kits definitely had the best enrichment level out of all. However, none of the other samples had any enrichment.

Latest revision as of 23:48, 26 March 2010

Prepare genomic DNA for hybridization[edit]

  • samples to be prepared:
  • sample 1: CVF-gDNA
  • sample 2: CViB-gDNA

two sheared gDNA received from Harvard:

  • sample 3: CD1 PGP1 ips P16 (30ul)
  • sample 4: PGP1F 8 gDNA (30ul)

End-repair Reactions[edit]

Fragmented DNA                             85 ul   30ul for sample 3,4
10X End Repair Reaction Buffer             10 ul   4ul for sample 3,4
End Repair Enzyme Mix                      5  ul   5ul for sample 3,4
Keep the tube at room temperature (~20°C) for 30 minutes.
Purify with Qiaquick column and elute in 40ul ddH2O
Note: for blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the
chance of getting chimeric reads.
  • nanodrop result:
  • CVf: 45ng/ul *40ul
  • CD1 PGP1 ips P16: 137.8ng/ul
  • PGP1F 8 gDNA: 146.3ng/ul * 40ul

A-Tailing reactions[edit]

Blunt-end DNA                             40 ul
10X dA-Tailing Reaction Buffer (10X)       5 ul
Klenow Fragment (3’-5’ exo-)               3 ul
Incubated at 37C for 30min
purified the products with Qiaquick column and elute in 40ul ddH2O

adaptor ligation[edit]

Prepare adaptors (need to be done only for the first time): 
100uM PE-t: 20ul
100uM PE-b: 20ul
10x stoffel buffer:  10ul
H2O:        50ul
94C for 3 min, and then cool down to 20C at the rate of 0.1C/sec. 
commonly used adaptors:
Blunt-end adaptors:
5’NH2- ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’OH	 	Solexa_1_up
3’NH2-ATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-5’OH	        Solexa_1_lo_nop

TA adaptors (for the one adaptor protocol):
5- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3’OH		PE_t_adapter
3-CTTCTGCCGTATGCTCGAGAAGGCTAG-5’Phos	                t_adaptor_rc_s

regular Y adaptor:
PE_t_adaptor(top)              ACACTCTTTCCCTACACGACGCTCTTCCGATC*T              3'-Phosphorothioate bond	
PE_b_adaptor(bottom)           \\5phos\\GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG       5'-phosphorylation	
Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw 
cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time. 
adaptor:target molar ratio is 1:15
A-tailed DNA                               10 ul for CVF, 3ul for CViB, CD1 PGP1 ips, and PGP1F 8
20uM Y adaptor                             3 ul 
5X Quick ligase buffer                     10 ul  
Quick Ligase                                3 ul
H2O                                        24 ul for CVF, 31ul for CViB, CD1 PGP1 ips, and PGP1F 8                                      
Incubate at room temperature for 15 minutes
purify the product with Agencourt AMpure kit and elute in 40ul ddH2O

PCR[edit]

Ligation products                 5ul      (2 well for each set, total of 8 well) 
100uM Solexa_PCR_up               0.2ul        
100uM solexa_PCR-lo               0.2ul
2X phusion HF master mix          50ul     
50X SYBR Green I                  0.4ul      
H2O                               45ul       
PCR program: 98 °C 30sec  -> 13 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold. 
purify the products with Qiagen Qiaquick columns and elute in 40ul ddH2O

Biotin-labeled probe capture[edit]

  • gDNA samples of DF and foreskin will be used, and the preparation protocol can be found under labnote 2-1-2010

working buffer preparation[edit]

1x binding buffer: (1M NaCl, 10mM Tris-HCl pH 7.5, 1mM EDTA)

Hybrid selection[edit]

Mix the following to 20ul total volume: 
1ug ligated DNA with 200ng padlock probes
2.5ug of human Cot-1 DNA
2ul of 10X AmpLigase buffer
1ul of 100uM competing oligos each (Solexa_up and Solexa_lo)
[gDNA]
DF6-9-9: 221ng/ul (5ul needed)
foreskin: 153ng/ul (6.5ul needed)
exome probe set 1: w/o PAGE selection (with Jan09 1-5,8,9,Mar R2, R3): 7ng/ul (28ul needed)
exome probe set 2: w/ PAGE selection (Jan09 1-5,8,9): 7ng/ul (28ul)

system setup (all units are in ul):

reagents DF DF(for exome probe set2) foreskin
DNA 5 5 6.5
probe 28 28 28
10x ampligase buffer 5 5 5
human Cot-1 DNA 2.5 2.5 2.5
Solexa_up (100uM) 1 1 1
Solexa_lo (100uM) 1 1 1
ddH2O 6 6 4.5
total: 50 50 50
95C 5min -> cool down to 60C at 0.01C/sec -> 60C 24 hours -> 50C 24 hours.

Prepare the Streptavidin Dynabeads[edit]

a. Take 50ul M-280 streptavidin Dynalbeads per reaction, place the tube on magnet and remove the liquid when the solution becomes clear
b. add twice the volume of the beads of 1x binding buffer, place the tube on magnet and remove the liquid when the solution becomes clear
c. wash the beads for a total of  3 times with the 1x binding buffer (1M NaCl, 10mM Tris-HCl pH 7.5, 1mM EDTA)
d. resuspend the beads in 200ul 1x binding buffer, warm up to 45C. 
c. Add the 20ul hybridization mix to 200ul M-280 beads, incubate at 45C in the Thermal Mixer at 300rpm for 30 min, take 1/2 and go on with no wash. 
d. Remove the liquid from the beads with a magnet.
e. Perform three 10-min wash with 0.5ml pre-warm 0.1x SSC and 0.1% SDS at 45C.
f. After the final wash, resuspend the beads with 50ul 0.1M NaOH, incubate at RT for 10min.
g. Separate the supernatant from the beads with a magnet, and transfer the supernatant (eluted DNA) to 70ul 1M Tris-HCl, pH 7.5. 
h. Purifythe 120ul neutralized DNA with a Qiaquick column, eluted with 30ul EB.

Post-capture PCR (done on 3/15/10)[edit]

a.Set up the reaction system with Phusion High-Fidelity PCR master mix:
  2x Phusion master mix:     50ul
  100uM PCR_F		     0.5ul
  100uM PCR_R		     0.5ul
  50X SYBG I		     0.8ul
  Captured DNA		     15ul
  H2O 			     44ul
b.Perform real-time PCR with 98C 30s -> 20 x (98C 10s -> 63C 20s-> 72C 20s) -> 72C 2min. 
First batch of samples used 20 cycles. For second batch of samples, DF N.W. and DF #2 N.W. only used 15 cycles, while the other had 19 cycles.
Terminate the reaction when the amplification curves approach to the plateau.
purify the products with Qiaquick columns and elute in 30ul EB
Nanodrop result:
DF N.W:         177.4ng/ul
DF set#2 45C:   34.7ng/ul
DF set#2 N.W.:  208.8ng/ul
DF 45C:         141ng/ul
foreskin 45C:   158.6ng/ul
foreskin N.W.:  224.8ng/ul

PAGE gel image:
File:ZhangLab 2 2010-03-15 16hr 33min.jpg File:ZhangLab 2 2010-03-15 16hr 36min.jpg

Measurement of Enrichment using qPCR on biotin-labeled probe capture sample[edit]

  • The qPCR assay is used to estimate relative fold-enrichment by measuring the relative abundance of control targets in amplified sample library and amplified captured DNA to determine whether the capture was successful.

Preparation of reagents[edit]

NSC qPCR assay name primer sequence 5'->3' Tm ( C) length
NSC-0237 F: CGCATTCCTCATCCCAGTATG 81.15 80bp
R: AAAGGACTTGGTGCAGAGTTCAG
NSC-0247 F: CCCACCGCCTTCGACAT 81.03 74bp
R: CCTGCTTACTGTGGGCTCTTG
NSC-0268 F: CTCGCTTAACCAGACTCATCTACTGT 78.99 75bp
R: ACTTGGCTCAGCTGTATGAAGGT
NSC-0272 F: CAGCCCCAGCTCAGGTACAG 82.23 71bp
R: ATGATGCGAGTGCTGATGATG
  • These are the primers that I have designed to test the enrichment level of my probes
qPCR assay name chromosome position primer sequence 5'->3'
QPCR_chr5_L chr5:176328156-176328295 CCCTTCTCTGAAAAGCTCCT
QPCR_chr5_R TGCAGTGATACAAGAACATGC
QPCR_chr7_L chr7:77048663-77048795 GGCAAGAAAAGAGGTGAAGC
QPCR_chr7_R GCACCAGATAGCTAGACCAG
QPCR_chr11_L chr11:5925385-5925520 TTGGGATGGTTGCCTTTTTG
QPCR_chr11_R GCCATTCCATGGTGGTAAGT
QPCR_chr10_L chr10:17952266-17952400 GCCGGAGTAGTCATCATTGT
QPCR_chr10_R TAGGTGCACACGTCTTTTCT
  • NOTE: The primer design above is NOT accurate! The DNA sequence above were taken from assembly Feb. 2009 (GRCh37/hg19), however, the probe design used assembly Mar. 2006 (NCBI36/hg18). Therefore, these primers will be need to be redesigned!
  1. Dilute the NSC assay forward and reverse primers to 2μM.
  2. Dilute sufficient amounts of amplified sample library and amplified captured DNA to a concentration of 5ng/μl in PCR grade water for use as qPCR templates

PCR reaction setup[edit]

                                              x6    x3(3 primers:chr5,7,11)
PCR grade water                   19.7ul
Primer R+F(2uM each)              2ul
template (5ng/ul)                 3.3ul
KAPA 2x master mix                25ul
95C 3min -> (95C 3sec -> 60C 20sec -> 72C 3sec) x40 -> 72C 3min -> 15C hold

results[edit]

sample ID efficiency C(t) d=sample C(t) -gDNA C(t) enrichment ratio = 1/ 2^d mean '
DF-no wash-Chr11 N/A N/A
DF-no wash-Chr11 N/A N/A
DF-no wash-Chr7 26.11% 30.45 2.36 0.19 0.16
DF-no wash-Chr7 22.00% 31.34 3.09 0.12
DF-no wash-Chr5 N/A N/A
DF-no wash-Chr5 N/A N/A
DF set2-no wash-Chr11 N/A N/A
DF set2-no wash-Chr11 N/A N/A
DF set2-no wash-Chr7 25.07% 30.43 2.34 0.2 0.17
DF set2-no wash-Chr7 26.02% 30.97 2.72 0.15
DF set2-no wash-Chr5 N/A N/A
DF set2-no wash-Chr5 N/A N/A
DF-45C wash-Chr11 N/A N/A
DF-45C wash-Chr11 N/A N/A
DF-45C wash-Chr7 25.28% 29.96 1.87 0.27 0.33
DF-45C wash-Chr7 24.78% 29.64 1.39 0.38
DF-45C wash-Chr5 N/A N/A
DF-45C wash-Chr5 N/A N/A
DF set2-45C wash-Chr11 N/A N/A
DF set2-45C wash-Chr11 N/A N/A
DF set2-45C wash-Chr7 N/A N/A
DF set2-45C wash-Chr7 N/A N/A
DF set2-45C wash-Chr5 N/A N/A
DF set2-45C wash-Chr5 N/A N/A
foreskin-no wash-chr 11 N/A N/A
foreskin-no wash-chr 11 N/A N/A
foreskin-no wash-chr 7 31.87% 29.35 1.26 0.42 0.3
foreskin-no wash-chr 7 27.05% 30.75 2.5 0.18
foreskin-no wash-chr 5 N/A N/A
foreskin-no wash-chr 5 N/A N/A
DF-gDNA-chr11 N/A N/A
DF-gDNA-chr11 N/A N/A
DF-gDNA-chr7 18.21% 28.09
DF-gDNA-chr7 19.17% 28.25
DF-gDNA-chr5 N/A N/A
DF-gDNA-chr5 N/A N/A

conclusion[edit]

  • It seems like we were able to capture regions covered on chr7, however, we didn't get any enrichment on these regions.
  • For DF set2 with 45C wash, I didn't get good amount of amplification during the last PCR step, I would think this is somewhat related to the low/zero enrichment level we seen in the graph. However, this is inconsistent with our previous results. Actually, in last enrichment analysis PCR, I found a mistake. I used SYBR green along with Kapa master mix. Kapa already included SYBR green, therefore adding extra SYBR green should be problematic (high concentration causes inhibition), thus the results from last time wasn't too trustworthy.
  • On chr11, I saw slight rise in the curve toward very late stage of PCR on the gDNA samples. It would be good to repeat another QPCR with 50 cycles or so to see whether we will get anything useful. I am planning to do another QPCR analysis to test chr10, four NSC primers, and repeat chr7 on different 6 samples(since PCR is limited to 96 wells).

2nd PCR reaction setup (done on 3/16/10)[edit]

                                             x8    x6(6 primers:4 NSC, chr7,10)     
PCR grade water                   19.7ul
Primer R+F(2uM each)              2ul
template (5ng/ul)                 3.3ul
iq SYBR green 2x master mix       25ul
95C 3min -> (95C 15sec -> 60C 20sec -> 72C 30sec) x40 -> 72C 3min -> 15C hold

results[edit]

sample ID Efficiency C(t) d1=Sample C(t) – gDNA C(t) enrichment ratio: 1/2^d mean median d2=sample C(t) – Nimblegen data C(t) enrichment ratio: 1/2^d2 mean median
DF-no wash-Chr11 34.84% 28.27 3.92 0.07 0.13 0.1 8.67 0.00246 0.22 0
DF-no wash-Chr11 33.29% 28.14 3.35 0.1 8.17 0.00347
DF-no wash-Chr7 42.42% 26.18 3.76 0.07 -0.92 1.89212
DF-no wash-Chr7 52.80% 25.93 3.34 0.1 0.35 0.78458
DF-no wash-NSC 237 44.30% 27.89 3.18 0.11 11.28 0.00040
DF-no wash-NSC 237 37.19% 28.69 2.42 0.19 12.65 0.00016
DF-no wash-NSC 268 44.07% 26.56 2.75 0.15 11.41 0.00037
DF-no wash-NSC 268 46.93% 26.55 1.84 0.28 11.76 0.00029
DF-no wash-NSC 247 19.11% 28.86 5 0.03 13.05 0.00012
DF-no wash-NSC 247 17.82% 30.36 6.36 0.01 14.05 0.00006
DF-no wash-NSC 272 27.54% 29.12 3.19 0.11 11.74 0.00029
DF-no wash-NSC 272 35.59% 28.58 1.79 0.29 10.87 0.00053
DF set2-no wash-Chr11 34.16% 28.03 3.68 0.08 0.23 0.19 8.43 0.00290 0.29 0
DF set2-no wash-Chr11 40.07% 27.99 3.2 0.11 8.02 0.00385
DF set2-no wash-Chr7 50.85% 25.66 3.24 0.11 -1.44 2.71321
DF set2-no wash-Chr7 40.60% 26 3.41 0.09 0.42 0.74742
DF set2-no wash-NSC 237 37.64% 28.21 3.5 0.09 11.6 0.00032
DF set2-no wash-NSC 237 40.56% 28.68 2.41 0.19 12.64 0.00016
DF set2-no wash-NSC 268 42.94% 26.13 2.32 0.2 10.98 0.00050
DF set2-no wash-NSC 268 42.47% 26.31 1.6 0.33 11.52 0.00034
DF set2-no wash-NSC 247 44.94% 24.9 1.04 0.49 9.09 0.00184
DF set2-no wash-NSC 247 35.02% 25.15 1.15 0.45 8.84 0.00218
DF set2-no wash-NSC 272 44.63% 27.69 1.76 0.3 10.31 0.00079
DF set2-no wash-NSC 272 34.67% 28.18 1.39 0.38 10.47 0.00071
DF-45C wash-Chr11 34.35% 28.12 3.77 0.07 0.18 0.17 8.52 0.00272 0.49 0
DF-45C wash-Chr11 33.56% 28.31 3.52 0.09 8.34 0.00309
DF-45C wash-Chr7 38.31% 25.09 2.67 0.16 -2.01 4.02782
DF-45C wash-Chr7 49.62% 24.74 2.15 0.23 -0.84 1.79005
DF-45C wash-NSC 237 39.28% 28.27 3.56 0.08 11.66 0.00031
DF-45C wash-NSC 237 39.49% 28.23 1.96 0.26 12.19 0.00021
DF-45C wash-NSC 268 49.68% 26.87 3.06 0.12 11.72 0.00030
DF-45C wash-NSC 268 51.21% 26.8 2.09 0.23 12.01 0.00024
DF-45C wash-NSC 247 40.09% 25.39 1.53 0.35 9.58 0.00131
DF-45C wash-NSC 247 40.44% 25.79 1.79 0.29 9.48 0.00140
DF-45C wash-NSC 272 38.29% 29.37 3.44 0.09 11.99 0.00025
DF-45C wash-NSC 272 38.71% 29.29 2.5 0.18 11.58 0.00033
foreskin-no wash-chr 10 43.11% 26.85 2.5 0.18 0.29 0.21
foreskin-no wash-chr 10 41.44% 26.97 2.18 0.22
foreskin-no wash-chr 7 48.40% 25.36 2.94 0.13
foreskin-no wash-chr 7 48.11% 25.59 3 0.13
foreskin-no wash-NSC 237 45.61% 27.89 3.18 0.11
foreskin-no wash-NSC 237 36.37% 28.6 2.33 0.2
foreskin-no wash-NSC 268 40.52% 26.08 2.27 0.21
foreskin-no wash-NSC 268 41.44% 26.2 1.49 0.36
foreskin-no wash-NSC 247 45.23% 24.67 0.81 0.57
foreskin-no wash-NSC 247 37.46% 25.16 1.16 0.45
foreskin-no wash-NSC 272 43.49% 27.15 1.22 0.43
foreskin-no wash-NSC 272 41.18% 27.64 0.85 0.55
foreskin-45C-chr 10 40.86% 26.6 2.25 0.21 0.17 0.15
foreskin-45C-chr 10 41.86% 26.66 1.87 0.27
foreskin-45C-chr 7 44.72% 25.26 2.84 0.14
foreskin-45C-chr 7 44.65% 25.2 2.61 0.16
foreskin-45C-NSC 237 43.36% 28.64 3.93 0.07
foreskin-45C-NSC 237 33.89% 29.73 3.46 0.09
foreskin-45C-NSC 268 49.90% 25.96 2.15 0.23
foreskin-45C-NSC 268 41.19% 26.18 1.47 0.36
foreskin-45C-NSC 247 43.75% 26.49 2.63 0.16
foreskin-45C-NSC 247 35.44% 27.08 3.08 0.12
foreskin-45C-NSC 272 44.04% 29.03 3.1 0.12
foreskin-45C-NSC 272 43.25% 29.86 3.07 0.12
foreskin-gDNA-chr10 27.51% 24.35
foreskin-gDNA-chr10 29.77% 24.79
foreskin-gDNA-chr7 36.64% 22.42
foreskin-gDNA-chr7 38.12% 22.59
foreskin-gDNA-NSC 237 33.36% 24.71
foreskin-gDNA-NSC 237 24.24% 26.27
foreskin-gDNA-NSC 268 37.41% 23.81
foreskin-gDNA-NSC 268 28.89% 24.71
foreskin-gDNA-NSC 247 34.97% 23.86
foreskin-gDNA-NSC 247 27.15% 24
foreskin-gDNA-NSC 272 37.33% 25.93
foreskin-gDNA-NSC 272 30.36% 26.79
DF-nimblegen-chr10 37.15% 19.6
DF-nimblegen-chr10 39.72% 19.97
DF-nimblegen-chr7 23.10% 27.1
DF-nimblegen-chr7 34.14% 25.58
DF-nimblegen-NSC 237 39.28% 16.61
DF-nimblegen-NSC 237 33.44% 16.04
DF-nimblegen-NSC 268 35.90% 15.15
DF-nimblegen-NSC 268 41.22% 14.79
DF-nimblegen-NSC 247 41.80% 15.81
DF-nimblegen-NSC 247 34.62% 16.31
DF-nimblegen-NSC 272 37.82% 17.38
DF-nimblegen-NSC 272 38.79% 17.71

conclusion[edit]

  • From the above results, we can conclude that commercialized Nimblegen kits definitely had the best enrichment level out of all. However, none of the other samples had any enrichment.