Matt:LabNotes/2013-7-11: Difference between revisions
Jump to navigation
Jump to search
>Mzcai |
>Mzcai mNo edit summary |
||
(3 intermediate revisions by the same user not shown) | |||
Line 8: | Line 8: | ||
*[http://genome-tech.ucsd.edu/LabNotes/index.php/Illumina_GA/Oligo_info#Primers_for_LC_Sciences_library-free_protocol Primers for Agi26k] | *[http://genome-tech.ucsd.edu/LabNotes/index.php/Illumina_GA/Oligo_info#Primers_for_LC_Sciences_library-free_protocol Primers for Agi26k] | ||
*Primers for CES36k18bp: AmpF6. | *[http://genome-tech.ucsd.edu/LabNotes/index.php/Illumina_GA/Oligo_info#Library_Free_Multiplexing_Primers Primers for CES36k18bp: AmpF6.3Sol and AmpR6.3Ind48] | ||
{| {{table}} border = 1 | {| {{table}} border = 1 | ||
Line 21: | Line 21: | ||
| 3||cDNA-Agi26k_20gap||Indx78 | | 3||cDNA-Agi26k_20gap||Indx78 | ||
|- | |- | ||
| 4||gDNA-CES36k18bp|| | | 4||gDNA-CES36k18bp||Indx48 | ||
|} <br> | |} <br> | ||
Line 44: | Line 44: | ||
Program | Program | ||
*98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x16 cycles -> 72°C 3 min -> 15°C hold | *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x16 cycles -> 72°C 3 min -> 15°C hold | ||
[[File:071113_PCRAgi20gapProbes_PosCtrl.JPG | 500px]] | |||
*Expected curves from NTC and PosCtrl (CES36k18bp probes) | |||
*Means the low efficiency of the Agi26k_20gap probes in previous capture reaction was not due to experimental error | |||
**The NTC from previous reaction was most likely due to not adding ExoI/III mix and/or contamination |
Latest revision as of 23:23, 11 July 2013
Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-7-9
Amplification with Sequencing Adapters[edit]
- Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007)
Tube # | Sample | Index# |
1 | NTC-Agi26k_20gap | Indx7 |
2 | gDNA-Agi26k_20gap | Indx77 |
3 | cDNA-Agi26k_20gap | Indx78 |
4 | gDNA-CES36k18bp | Indx48 |
Components | 1X Reaction | 5X Reaction |
Captured Template | 1 | 0 |
10uM Forward + Indx | 0.4 | 0 |
10uM Reverse | 0.4 | 2.0 |
2X KAPA SYBG FAST MM | 12.5 | 62.5 |
H2O | 10.7 | 53.5 |
Total | 25 | 125 |
Program *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x16 cycles -> 72°C 3 min -> 15°C hold
File:071113 PCRAgi20gapProbes PosCtrl.JPG
- Expected curves from NTC and PosCtrl (CES36k18bp probes)
- Means the low efficiency of the Agi26k_20gap probes in previous capture reaction was not due to experimental error
- The NTC from previous reaction was most likely due to not adding ExoI/III mix and/or contamination