Rui:LabNotes/SingleCell/2013-7-31: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>RuiLiu
>RuiLiu
 
(11 intermediate revisions by the same user not shown)
Line 3: Line 3:
* I didn't use Betaine because it hasn't come in yet
* I didn't use Betaine because it hasn't come in yet
* mNPC plate was sorted on 7.10.13 in hiMg buffer [http://genome-tech.ucsd.edu/LabNotes/index.php/Blue:RNA-Seq_Experiments:07252013]
* mNPC plate was sorted on 7.10.13 in hiMg buffer [http://genome-tech.ucsd.edu/LabNotes/index.php/Blue:RNA-Seq_Experiments:07252013]
* I only have 24 RL.T7.id01-24 with no VN
* I also use 24 T20V.id01-24 for TSO or 2 step IVT


===Design===
===Design===
[[File:7.31.13_design.jpg|600px]]
 
[[File:7.31.13_mNPC-display.jpg]]
 
[[File:7.31.13_mNPC-seq.jpg]]


===Procedures===
===Procedures===
* 2ul Lysis: the long procedure originally used for fluidigm
* 3ul PNK: 1mM ATP, RNase-In (1:2d), PNK (1:2d)
* 4ul PAP: 1mM ATP, PAP (1:10d)
* 10ul RT: 3ul 0.2uM T20.id01-24 or RL.T7.id01-24
* beads pools into 4 tubes, 3 column each (240ul beads + 240ul rec.)
* TSO with TSO.r04 or TSO.r05 (LNA)
* 2nd strand in 20ul
* T7 addition for T20.id01-24 for 2 step IVT
* beads purification
* IVT in 20ul for 12 hrs
* Directly take 2ul for a quick run (RT-PCR), purify the rest with Zymo kit
* RT with N6 or N9
* QPCR for 12 cycles
* Redo RT-PCR with adjusted aRNA input (3ul, 6ul, 6ul, 6ul from IVT-1,2,3,4)
* The rest of aRNAs were store at -80C (Rui Cell (MEF) box) with label 8.1.13 IVT#1,2,3,4.
* beads purification or size selection (if primer-dimer is an issue)


===Results===
===Results===
*IVT-1: 24 SCs (RL.T7.id01-24), 1 step IVT, N6 RT-PCR, N2.id09
*IVT-2: 24 SCs (RL.T7.id01-24), 1 step IVT, N9 RT-PCR, N2.id10
*IVT-3: 12 SCs (T20.id01-24), 2 step IVT, N6 RT-PCR, N2.id11
*IVT-4: 12 SCs (T20.id01-24), 2 step IVT, N9 RT-PCR, N2.id12
*IVT-1: 12 SCs (T20.id01-24), TSO with TSO.r04, N2.id14
*IVT-2: 12 SCs (T20.id01-24), TSO with TSO.r05, N2.id15
[[File:8.1.13_IVT-TSO.jpg]]


===Libraries===
===Libraries===
#IVT1: RL-hiMgIVT_N2id09-Aug1
#IVT2: RL-hiMgIVT_N2id10-Aug1
#IVT3: RL-hiMgIVT_N2id11-Aug1
#IVT4: RL-hiMgIVT_N2id12-Aug1
#TSO1: RL-hiMgTSO_N2id14-Aug1
#TSO2: RL-hiMgTSO_N2id15-Aug1
[[File:8.2.13_final check.jpg]]
Read 1: [totoRNAseq Read 1 v2] CCACCGAGATCTACACTCTTTCCCTACACGACG
Read 2: [N2 Read 2]
Barcode read:
*[N2Indseq]
*[RL.T7.IndSeq] AAAAAAAAAAAAAAAAAAAAGCGGGCTGGCAAGG

Latest revision as of 19:09, 6 August 2013

mNPC plate with the latest version of hiMg-TSO and hiMg-IVT protocols[edit]

  • The latest version of hiMg-TSO and hiMg-IVT protocols confirmed on 7/29/13
  • I didn't use Betaine because it hasn't come in yet
  • mNPC plate was sorted on 7.10.13 in hiMg buffer [1]
  • I only have 24 RL.T7.id01-24 with no VN
  • I also use 24 T20V.id01-24 for TSO or 2 step IVT

Design[edit]

File:7.31.13 mNPC-display.jpg

File:7.31.13 mNPC-seq.jpg

Procedures[edit]

  • 2ul Lysis: the long procedure originally used for fluidigm
  • 3ul PNK: 1mM ATP, RNase-In (1:2d), PNK (1:2d)
  • 4ul PAP: 1mM ATP, PAP (1:10d)
  • 10ul RT: 3ul 0.2uM T20.id01-24 or RL.T7.id01-24
  • beads pools into 4 tubes, 3 column each (240ul beads + 240ul rec.)
  • TSO with TSO.r04 or TSO.r05 (LNA)
  • 2nd strand in 20ul
  • T7 addition for T20.id01-24 for 2 step IVT
  • beads purification
  • IVT in 20ul for 12 hrs
  • Directly take 2ul for a quick run (RT-PCR), purify the rest with Zymo kit
  • RT with N6 or N9
  • QPCR for 12 cycles
  • Redo RT-PCR with adjusted aRNA input (3ul, 6ul, 6ul, 6ul from IVT-1,2,3,4)
  • The rest of aRNAs were store at -80C (Rui Cell (MEF) box) with label 8.1.13 IVT#1,2,3,4.
  • beads purification or size selection (if primer-dimer is an issue)

Results[edit]

  • IVT-1: 24 SCs (RL.T7.id01-24), 1 step IVT, N6 RT-PCR, N2.id09
  • IVT-2: 24 SCs (RL.T7.id01-24), 1 step IVT, N9 RT-PCR, N2.id10
  • IVT-3: 12 SCs (T20.id01-24), 2 step IVT, N6 RT-PCR, N2.id11
  • IVT-4: 12 SCs (T20.id01-24), 2 step IVT, N9 RT-PCR, N2.id12
  • IVT-1: 12 SCs (T20.id01-24), TSO with TSO.r04, N2.id14
  • IVT-2: 12 SCs (T20.id01-24), TSO with TSO.r05, N2.id15

File:8.1.13 IVT-TSO.jpg

Libraries[edit]

  1. IVT1: RL-hiMgIVT_N2id09-Aug1
  2. IVT2: RL-hiMgIVT_N2id10-Aug1
  3. IVT3: RL-hiMgIVT_N2id11-Aug1
  4. IVT4: RL-hiMgIVT_N2id12-Aug1
  5. TSO1: RL-hiMgTSO_N2id14-Aug1
  6. TSO2: RL-hiMgTSO_N2id15-Aug1

File:8.2.13 final check.jpg

Read 1: [totoRNAseq Read 1 v2] CCACCGAGATCTACACTCTTTCCCTACACGACG

Read 2: [N2 Read 2]

Barcode read:

  • [N2Indseq]
  • [RL.T7.IndSeq] AAAAAAAAAAAAAAAAAAAAGCGGGCTGGCAAGG