Rui:LabNotes/SingleCell/2013-7-31: Difference between revisions
Jump to navigation
Jump to search
>RuiLiu m (→Samples) |
>RuiLiu m (→Libraries) |
||
(11 intermediate revisions by the same user not shown) | |||
Line 3: | Line 3: | ||
* I didn't use Betaine because it hasn't come in yet | * I didn't use Betaine because it hasn't come in yet | ||
* mNPC plate was sorted on 7.10.13 in hiMg buffer [http://genome-tech.ucsd.edu/LabNotes/index.php/Blue:RNA-Seq_Experiments:07252013] | * mNPC plate was sorted on 7.10.13 in hiMg buffer [http://genome-tech.ucsd.edu/LabNotes/index.php/Blue:RNA-Seq_Experiments:07252013] | ||
* I only have 24 RL.T7.id01-24 with no VN | |||
* I also use 24 T20V.id01-24 for TSO or 2 step IVT | |||
===Design=== | ===Design=== | ||
[[File:7.31. | |||
[[File:7.31.13_mNPC-display.jpg]] | |||
[[File:7.31.13_mNPC-seq.jpg]] | |||
===Procedures=== | ===Procedures=== | ||
* 2ul Lysis: the long procedure originally used for fluidigm | |||
* 3ul PNK: 1mM ATP, RNase-In (1:2d), PNK (1:2d) | |||
* 4ul PAP: 1mM ATP, PAP (1:10d) | |||
* 10ul RT: 3ul 0.2uM T20.id01-24 or RL.T7.id01-24 | |||
* beads pools into 4 tubes, 3 column each (240ul beads + 240ul rec.) | |||
* TSO with TSO.r04 or TSO.r05 (LNA) | |||
* 2nd strand in 20ul | |||
* T7 addition for T20.id01-24 for 2 step IVT | |||
* beads purification | |||
* IVT in 20ul for 12 hrs | |||
* Directly take 2ul for a quick run (RT-PCR), purify the rest with Zymo kit | |||
* RT with N6 or N9 | |||
* QPCR for 12 cycles | |||
* Redo RT-PCR with adjusted aRNA input (3ul, 6ul, 6ul, 6ul from IVT-1,2,3,4) | |||
* The rest of aRNAs were store at -80C (Rui Cell (MEF) box) with label 8.1.13 IVT#1,2,3,4. | |||
* beads purification or size selection (if primer-dimer is an issue) | |||
===Results=== | ===Results=== | ||
*IVT-1: 24 SCs (RL.T7.id01-24), 1 step IVT, N6 RT-PCR, N2.id09 | |||
*IVT-2: 24 SCs (RL.T7.id01-24), 1 step IVT, N9 RT-PCR, N2.id10 | |||
*IVT-3: 12 SCs (T20.id01-24), 2 step IVT, N6 RT-PCR, N2.id11 | |||
*IVT-4: 12 SCs (T20.id01-24), 2 step IVT, N9 RT-PCR, N2.id12 | |||
*IVT-1: 12 SCs (T20.id01-24), TSO with TSO.r04, N2.id14 | |||
*IVT-2: 12 SCs (T20.id01-24), TSO with TSO.r05, N2.id15 | |||
[[File:8.1.13_IVT-TSO.jpg]] | |||
===Libraries=== | ===Libraries=== | ||
#IVT1: RL-hiMgIVT_N2id09-Aug1 | |||
#IVT2: RL-hiMgIVT_N2id10-Aug1 | |||
#IVT3: RL-hiMgIVT_N2id11-Aug1 | |||
#IVT4: RL-hiMgIVT_N2id12-Aug1 | |||
#TSO1: RL-hiMgTSO_N2id14-Aug1 | |||
#TSO2: RL-hiMgTSO_N2id15-Aug1 | |||
[[File:8.2.13_final check.jpg]] | |||
Read 1: [totoRNAseq Read 1 v2] CCACCGAGATCTACACTCTTTCCCTACACGACG | |||
Read 2: [N2 Read 2] | |||
Barcode read: | |||
*[N2Indseq] | |||
*[RL.T7.IndSeq] AAAAAAAAAAAAAAAAAAAAGCGGGCTGGCAAGG |
Latest revision as of 19:09, 6 August 2013
mNPC plate with the latest version of hiMg-TSO and hiMg-IVT protocols[edit]
- The latest version of hiMg-TSO and hiMg-IVT protocols confirmed on 7/29/13
- I didn't use Betaine because it hasn't come in yet
- mNPC plate was sorted on 7.10.13 in hiMg buffer [1]
- I only have 24 RL.T7.id01-24 with no VN
- I also use 24 T20V.id01-24 for TSO or 2 step IVT
Design[edit]
Procedures[edit]
- 2ul Lysis: the long procedure originally used for fluidigm
- 3ul PNK: 1mM ATP, RNase-In (1:2d), PNK (1:2d)
- 4ul PAP: 1mM ATP, PAP (1:10d)
- 10ul RT: 3ul 0.2uM T20.id01-24 or RL.T7.id01-24
- beads pools into 4 tubes, 3 column each (240ul beads + 240ul rec.)
- TSO with TSO.r04 or TSO.r05 (LNA)
- 2nd strand in 20ul
- T7 addition for T20.id01-24 for 2 step IVT
- beads purification
- IVT in 20ul for 12 hrs
- Directly take 2ul for a quick run (RT-PCR), purify the rest with Zymo kit
- RT with N6 or N9
- QPCR for 12 cycles
- Redo RT-PCR with adjusted aRNA input (3ul, 6ul, 6ul, 6ul from IVT-1,2,3,4)
- The rest of aRNAs were store at -80C (Rui Cell (MEF) box) with label 8.1.13 IVT#1,2,3,4.
- beads purification or size selection (if primer-dimer is an issue)
Results[edit]
- IVT-1: 24 SCs (RL.T7.id01-24), 1 step IVT, N6 RT-PCR, N2.id09
- IVT-2: 24 SCs (RL.T7.id01-24), 1 step IVT, N9 RT-PCR, N2.id10
- IVT-3: 12 SCs (T20.id01-24), 2 step IVT, N6 RT-PCR, N2.id11
- IVT-4: 12 SCs (T20.id01-24), 2 step IVT, N9 RT-PCR, N2.id12
- IVT-1: 12 SCs (T20.id01-24), TSO with TSO.r04, N2.id14
- IVT-2: 12 SCs (T20.id01-24), TSO with TSO.r05, N2.id15
Libraries[edit]
- IVT1: RL-hiMgIVT_N2id09-Aug1
- IVT2: RL-hiMgIVT_N2id10-Aug1
- IVT3: RL-hiMgIVT_N2id11-Aug1
- IVT4: RL-hiMgIVT_N2id12-Aug1
- TSO1: RL-hiMgTSO_N2id14-Aug1
- TSO2: RL-hiMgTSO_N2id15-Aug1
Read 1: [totoRNAseq Read 1 v2] CCACCGAGATCTACACTCTTTCCCTACACGACG
Read 2: [N2 Read 2]
Barcode read:
- [N2Indseq]
- [RL.T7.IndSeq] AAAAAAAAAAAAAAAAAAAAGCGGGCTGGCAAGG