Noi/NOTES/2014-10-15: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Noi
mNo edit summary
>Noi
mNo edit summary
 
(13 intermediate revisions by the same user not shown)
Line 1: Line 1:
= Expansion PCR of new probe set from CustomArrays (90k_oligos_30Sept2014) =
* [[noi:DMR220k_LabNotes| '''Link to calendar''']]
* [[noi:DMR220k_LabNotes| '''Link to calendar''']]
* 2014-10-15: Received :90k_oligos_30Sept2014 from CustomArray
* 2014-10-15: Received :90k_oligos_30Sept2014 from CustomArray
Line 4: Line 5:
* Name: 90k_oligos_30Sept2014
* Name: 90k_oligos_30Sept2014
* Conc. 69.89ng/ul,
* Conc. 69.89ng/ul,
* Volume 80ul in TE buffer. Total amount XXug
* Volume 80ul in TE buffer. Total amount 5.59ug
* [[Kun:LabNotes/MONOD/2014-8-4#Re-design_of_selector_probes| Info from Dr. Zhang's note]]
* [[Kun:LabNotes/MONOD/2014-8-4#Re-design_of_selector_probes| Info from Dr. Zhang's note]]
  *Sept14 probe set: [[Media:90k_oligos_30Sept2014.txt.gz]]
  *Sept14 probe set: [[Media:90k_oligos_30Sept2014.txt.gz]]
Line 24: Line 25:
  H2O                 4.01
  H2O                 4.01
  Total               10.00
  Total               10.00
* 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 18-> 72C 3min -> 15C hold
* 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 17-> 72C 3min -> 15C hold
[[File:2014-10-15_testExpPCR_Sep14probes.PNG| 500px]]
* The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification
* The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification
* <span style="color:red">I SHOULD HAVE VERIFIED AMPLICON SIZE IN TBE GEL BEFORE CONTINUE TO DO EXPANSION PCR IN A LARGE VOLUME EVEN THE qPCR CURVE SHOWED AMPLIFICATION AS USUAL.</span>
  '''Components         Volume (ul)'''
  '''Components         Volume (ul)'''
  Seed oligo (1694.3nM) 8.85
  Seed oligo (1694.3nM) 8.85
  F primer mix (10uM) 0.60
  F primer (10uM) 0.60
  R primer mix (10uM) 0.60
  R primer (10uM) 0.60
  2x KAPA SYBG fast MM 75.00
  2x KAPA SYBG fast MM 75.00
  H2O 64.95
  H2O 64.95
Line 35: Line 39:
* Split each set in 3X50ul  
* Split each set in 3X50ul  
* 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X '''16'''-> 72C 3min -> 15C hold
* 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X '''16'''-> 72C 3min -> 15C hold
[[File:2014-10-15_ExpPCR_Sep14probes_LMScluster-padlockSNP.png|500px]]
* Purify the 1st amplicons with 2x QIAquick column and elute with 50ul TE buffer
* Purify the 1st amplicons with 2x QIAquick column and elute with 50ul TE buffer
* Measure concentration by N.D.
* Measure concentration by N.D.
* Will add N.D. result.
* Will add N.D. result.
* I then continue to amplify cancer_hyb_sep14 probe set with the same condition of the quick test for the two subsets above for 16 cycles. The amplification worked fine at 16 cycles.
* I then continue to amplify cancer_hyb_sep14 probe set with the same condition of the quick test for the two subsets above for 15 cycles. The amplification worked fine at 15 cycles.
[[File:2014-10-15_testExpPCR_Sep14probes_v8.png|500px]]
* I ran all 1st round amplicon in 6% TBE gel
* I ran all 1st round amplicon in 6% TBE gel
** For quick test PCR product, I added 2ul of 6X loading dye to 10ul of PCR product and loaded 3ul in the gel. For column purified amplicons, I loaded 1ul for each
[[File:ZhangLab_2 2014-10-16 14hr 04min_test_ExpPCR_Verify.jpg| 400px]]
LMS = LMS_selector
padl = padlock_SNP
PTC = positive control
canc = cancer_hyb_sep14
* From the gel image, there is a smear below 100bp band in all the three subsets, which is unexpected. The amplicons size should be ~125-130bp. The sizeof  positive control are correct. I am pretty sure that I added the right reagents in each reaction. In addition, the result of expansion PCR in large volume of LMS_selector and padlock_SNP were consistent with the quick test PCR.
* I will check the result with Chris for his probe set to see if he has the same issue.
** [[Chris:LabNotes/FateMapping/Calendar/2014/2014-10-16| '''Chris's result''']]<br>
* From Chis's result, he got the similar smear below 100bp like the other three subsets amplified by me.
* I double-check the primer/adaptor sequences of the designed probes. The design is correct for the four subsets and the number of each subset agrees with Dr. Zhang's note.
** [[Media:2014-10-16-90k-sep14-primer-check.pdf|'''Primer/adaptor sequence check''']]
* Dr. Zhang notes that CustomArray has started to synthesize the new batch of these probe sets.

Latest revision as of 12:34, 24 December 2014

Expansion PCR of new probe set from CustomArrays (90k_oligos_30Sept2014)[edit]

Oligo info.[edit]

*Sept14 probe set: Media:90k_oligos_30Sept2014.txt.gz
           probe set           # probes    Length             Amp primers                                               
  Chris    gDNA_MS_v2            8,045      127bp  V6(G*T*CATATCGGTCACTGTU//5Phos/GGGTAGTGTGTATCCTG)      
  Kun      cancer_hyb_sept14    51,639  110-130bp  V8(T*C*TAATCTAGCGCGACGTCU//5Phos/CCACAAGAGGCGCTATG)   
  Kun      LMS_selector         17,342  124-130bp  NE(TGCCTAGGACCGGATCAACT/GCTTCGGTTCACGCAATG)           
  Kun      padlock_SNPs         12,974      125bp  V4(G*A*CTGGAAGAGCACTGTU//5Phos/AGCCTCATGCGTATCCG)         
                         Total  90,000
  • Length: I would use the average size of the oligo pool to calculate concentration ~125nt = MW=41250g/mole
  • Conc. : 69.89 ng/ul = 1694.30 (69.89ng/ul/ 41250g/mole)

Expansion PCR (Quick test, round1)[edit]

  • I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set)
  • I will include the two positive control for the two primer set to confirm that the amplification works fine. Note that I combine F & R primer in final conc. 10uM in the same tube.
Components	        Volume (ul)	Final conc.
Seed oligo (1694.3nM)	0.59	        100nM
F/R primer mix (10uM)	0.40	        400nM
2x KAPA SYBG fast MM	5.00	        1x
H2O	                4.01	
Total	               10.00
  • 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 17-> 72C 3min -> 15C hold
File:2014-10-15 testExpPCR Sep14probes.PNG
  • The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification
  • I SHOULD HAVE VERIFIED AMPLICON SIZE IN TBE GEL BEFORE CONTINUE TO DO EXPANSION PCR IN A LARGE VOLUME EVEN THE qPCR CURVE SHOWED AMPLIFICATION AS USUAL.
Components	        Volume (ul)
Seed oligo (1694.3nM)	8.85
F primer (10uM)	0.60
R primer (10uM)	0.60
2x KAPA SYBG fast MM	75.00
H2O	64.95
Total	150.00
  • Split each set in 3X50ul
  • 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 16-> 72C 3min -> 15C hold
File:2014-10-15 ExpPCR Sep14probes LMScluster-padlockSNP.png
  • Purify the 1st amplicons with 2x QIAquick column and elute with 50ul TE buffer
  • Measure concentration by N.D.
  • Will add N.D. result.
  • I then continue to amplify cancer_hyb_sep14 probe set with the same condition of the quick test for the two subsets above for 15 cycles. The amplification worked fine at 15 cycles.
File:2014-10-15 testExpPCR Sep14probes v8.png
  • I ran all 1st round amplicon in 6% TBE gel
    • For quick test PCR product, I added 2ul of 6X loading dye to 10ul of PCR product and loaded 3ul in the gel. For column purified amplicons, I loaded 1ul for each
File:ZhangLab 2 2014-10-16 14hr 04min test ExpPCR Verify.jpg

LMS = LMS_selector
padl = padlock_SNP
PTC = positive control
canc = cancer_hyb_sep14
  • From the gel image, there is a smear below 100bp band in all the three subsets, which is unexpected. The amplicons size should be ~125-130bp. The sizeof positive control are correct. I am pretty sure that I added the right reagents in each reaction. In addition, the result of expansion PCR in large volume of LMS_selector and padlock_SNP were consistent with the quick test PCR.
  • I will check the result with Chris for his probe set to see if he has the same issue.
  • From Chis's result, he got the similar smear below 100bp like the other three subsets amplified by me.
  • I double-check the primer/adaptor sequences of the designed probes. The design is correct for the four subsets and the number of each subset agrees with Dr. Zhang's note.
  • Dr. Zhang notes that CustomArray has started to synthesize the new batch of these probe sets.