Matt:LabNotes/2017-5-22: Difference between revisions
Jump to navigation
Jump to search
>Mzcai mNo edit summary |
>Mzcai |
||
(One intermediate revision by the same user not shown) | |||
Line 113: | Line 113: | ||
| align="right" | 3 | | align="right" | 3 | ||
| align="right" | 0 | | align="right" | 0 | ||
| 22.5 or 21.6 | | 22.5 or 21.6 | ||
| align="right" | 30 | | align="right" | 30 | ||
Line 185: | Line 185: | ||
Program | Program | ||
98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min | 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min | ||
**Results were all over the place. Inconsistent between triplicates |
Latest revision as of 22:45, 12 June 2017
Fifth Try: in tube SplintR Test with formamide[edit]
- First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried
- Second try had unexpected trend with increasing formamide led to increased sensitivity
- Third try confirmed second try
- Fourth try had unexpected non-continous trend
- Repeat Fourth Try with 95C 3min denature before hybridization
Test Conditions[edit]
- Standard: SplintR only
- SplintR + 5% formamide
- SplintR + 7.5% formamide
- SplintR + 10% formamide
- SplintR + 12.5% formamide
- SplintR + 15% formamide
- SplintR + 17.5% formamide
- Positive Control: Ampligase
- For each test conditions have
- one sample with ALL padlock probes and template
- Should see amplification
- one sample with all padlock probes with NO MALAT1 template
- Should not see amplification
- one sample with ALL padlock probes and template
Padlock Probes and Template[edit]
- ppCUX2
- ppBCL11B
- ppRELN_1
- ppGFAP
- ppMALAT1
- /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
- Template for ppMALAT1: MALAT1_template
- /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT
Protocol[edit]
Sample # | Condition | 30nM PP + Template | 10X Buffer | Formamide | H2O | Total |
1 | SplintR | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 22.5 or 21.6 | 30 |
2 | SplintR + 5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 1.5 | 21 or 20.1 | 30 |
3 | SplintR + 7.5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 2.25 | 20.25 or 19.35 | 30 |
4 | SplintR + 10% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 3 | 19.5 or 18.6 | 30 |
5 | SplintR + 12.5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 3.75 | 18.75 or 17.85 | 30 |
6 | SplintR + 15% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 4.5 | 18 or 17.1 | 30 |
7 | SplintR + 17.5 formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 5.25 | 17.25 or 16.35 | 30 |
8 | Ampligase | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 22.5 or 21.6 | 30 |
- Combine padlock probes and template in 1X Ligase buffer and possibly formamide
- Add mineral oil on top
- Incubate at 95C for 3min
- Incubate at 55C for 18hr
- To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
- Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
- Move samples 1-7 to 37C
- Add 3ul SplintR Mix and incubate 15min
- SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
- Incubate at 94C for 10min
- Put all samples on ice and add 2ul Exo I/III mix
- Incubate at 37C for 1hr
- Incubate at 94C for 10min
- qPCR all 16 samples with triplicates
Components | 1X Volume | 48X Volume |
Captured template | 1 | 0 |
10uM ISB_CA_AF | 0.4 | 19.2 |
10uM ISB_CA_AR.T2 | 0.4 | 19.2 |
2X KAPA SYBG MM | 12.5 | 600 |
H2O | 10.7 | 513.6 |
Total | 25 | 1,152 |
- Aliquot 24ul from 48X master mix and add 1ul captured template
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min
Results[edit]
raw data here
File:20170523 qPCR PPcapture SplintRformamide ScatterPlot.PNG
Repeat qPCR with 1/100 dilution[edit]
- For all 16 samples
- Do 2 serial dilutions of 1/10 to get 1/100
- 3ul + 27ul H2O -> 3ul + 27ul H2O
Components | 1X Volume | 48X Volume |
Captured template diluted 1:100 | 1 | 0 |
10uM ISB_CA_AF | 0.4 | 19.2 |
10uM ISB_CA_AR.T2 | 0.4 | 19.2 |
2X KAPA SYBG MM | 12.5 | 600 |
H2O | 10.7 | 513.6 |
Total | 25 | 1,152 |
- Aliquot 24ul from 48X master mix and add 1ul captured template
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min
- Results were all over the place. Inconsistent between triplicates