Chris:LabNotes/sci-Methyl Seq/Calendar/2017/2017-6-13: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Cjwei
>Cjwei
 
(17 intermediate revisions by the same user not shown)
Line 1: Line 1:
=sci-Methyl Seq Barcode 1 Design v3; Barcode 2 Design v2=
=sci-Methyl Seq Barcode 1 Design v4; Barcode 2 Design v3=
==Background==
==Background==
*Just yesterday, we designed new sci-Methyl Seq Adapter 1 and Adapter 2 sequences and ordered them to test whether we could ligate on Adapter 2 instead of using the current annealing method.  However, looking further into the protocol, it would be prudent to begin designing Adapter 1 such that it will be appropriate for bisulfite conversion and PCR.  In order to do this, we need to do the following:
*Just yesterday, we designed new sci-Methyl Seq Adapter 1 and Adapter 2 sequences and ordered them to test whether we could ligate on Adapter 2 instead of using the current annealing method.  However, looking further into the protocol, it would be prudent to begin designing Adapter 1 such that it will be appropriate for bisulfite conversion and PCR.  In order to do this, we need to do the following:
Line 6: Line 6:
**Create final PCR primers that will add the P5/P7 sequencing adapters to both ends of the DNA fragment
**Create final PCR primers that will add the P5/P7 sequencing adapters to both ends of the DNA fragment
==Overview==
==Overview==
*Below is a general overview of the experimental procedure to ligate Adpt1 and Adpt2 (same as <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-6-12> but with PCR added in).  NOTE: NoG sequences are in <span style="color:red">red/H</span>, NoC sequences are in <span style="color:blue">blue/D</span>.
*Below is a general overview of the experimental procedure to ligate Adpt1 and Adpt2 (same as <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-6-12> but with PCR added in).  '''NOTE: <span style="color:red">NoG</span> sequences are in <span style="color:red">red/H</span>, <span style="color:blue">NoC</span> sequences are in <span style="color:blue">blue/D</span>.'''
  <u>End Repair/dA-Tailing</u>
  <u>End Repair/dA-Tailing</u>
       5'  '''-----'''A 3'
       5'  '''-----'''A 3'
Line 14: Line 14:
             V
             V
   
   
  Add Adpt1_v3:    5' /5Phos/<span style="color:red">-----TTHH[Barcode1]-----CC</span> 3'
  Add Adpt1_v4:    5' /5Phos/<u>GT</u><span style="color:red">-----TTHH[Barcode1]-----CC</span> 3'
                   3'      <span style="color:blue">T-----AADD[''Barcode1'']-----</span> 5'
                   3'      <u>TCA</u><span style="color:blue">-----AADD[''Barcode1'']-----</span> 5'
   
   
             |
             |
             V
             V
   
   
  <u>Ligate Adpt1_v3 (using same optimized ligation protocol as before)</u>
  <u>Ligate Adpt1_v4 (using same optimized ligation protocol as before)</u>
       5'  <span style="color:blue">-----[''Barcode1'']DDAA-----T</span>|'''-----'''A|<span style="color:red">-----TTHH[Barcode1]-----CC</span> 3'
       5'  <span style="color:blue">-----[''Barcode1'']DDAA-----</span><u>ACT</u>|'''-----'''A|<u>GT</u><span style="color:red">-----TTHH[Barcode1]-----CC</span> 3'
       3' <span style="color:red">CC-----[Barcode1]HHTT-----</span>|A'''-----'''|<span style="color:blue">T-----AADD[''Barcode1'']-----</span> 5'
       3' <span style="color:red">CC-----[Barcode1]HHTT-----</span><u>TG</u>|A'''-----'''|<u>TCA</u><span style="color:blue">-----AADD[''Barcode1'']-----</span> 5'
   
   
             |
             |
             V
             V
   
   
  <u>Add Adpt2_v2:</u>    5' /5Phos/<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span> 3'
  <u>Add Adpt2_v3:</u>    5' /5Phos/<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span> 3'
                   3'      <span style="color:red">GG-----[Barcode2]'''HHHHHHHH'''-----</span> 5'
                   3'      <span style="color:red">GG-----[Barcode2]'''HHHHHHHH'''-----</span> 5'
   
   
Line 33: Line 33:
             V
             V
   
   
  <u>Ligate Adpt2_v2 (using same optimized ligation protocol as before)</u>
  <u>Ligate Adpt2_v3 (using same optimized ligation protocol as before)</u>
                                       Nick
                                       Nick
                                       V
                                       V
       5' <span style="color:red">-----'''HHHHHHHH'''[Barcode2]-----GG</span>|<span style="color:blue">-----[''Barcode1'']DDAA-----T</span>|'''-----'''A|<span style="color:red">-----TTHH[Barcode1]-----CC</span>|<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span> 3'
       5' <span style="color:red">-----'''HHHHHHHH'''[Barcode2]-----GG</span>|<span style="color:blue">-----[''Barcode1'']DDAA-----</span><u>ACT</u>|'''-----'''A|<u>GT</u><span style="color:red">-----TTHH[Barcode1]-----CC</span>|<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span> 3'
       3' <span style="color:blue">-----'''''DDDDDDDD'''''[''Barcode2'']-----</span>|<span style="color:red">CC-----[Barcode1]HHTT-----</span>|A'''-----'''|<span style="color:blue">T-----AADD[''Barcode1'']-----</span>|<span style="color:red">GG-----[Barcode2]'''HHHHHHHH'''-----</span> 5'
       3' <span style="color:blue">-----'''''DDDDDDDD'''''[''Barcode2'']-----</span>|<span style="color:red">CC-----[Barcode1]HHTT-----</span><u>TG</u>|A'''-----'''|<u>TCA</u><span style="color:blue">-----AADD[''Barcode1'']-----</span>|<span style="color:red">GG-----[Barcode2]'''HHHHHHHH'''-----</span> 5'
                                                                                                ^
                                                                                                    ^
                                                                                                Nick
                                                                                                    Nick
   
   
             |
             |
Line 45: Line 45:
   
   
  <u>Denature/separate fragments (will break up DNA at nicks)</u>
  <u>Denature/separate fragments (will break up DNA at nicks)</u>
                                     5' <span style="color:blue">-----[''Barcode1'']DDAA-----T</span>|'''-----'''A|<span style="color:red">-----TTHH[Barcode1]-----CC</span>|<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span> 3'
                                     5' <span style="color:blue">-----[''Barcode1'']DDAA-----</span><u>ACT</u>|'''-----'''A|<u>GT</u><span style="color:red">-----TTHH[Barcode1]-----CC</span>|<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span> 3'
   
   
     3' <span style="color:blue">-----'''''DDDDDDDD'''''[''Barcode2'']-----</span>|<span style="color:red">CC-----[Barcode1]HHTT-----</span>|A'''-----'''|<span style="color:blue">T-----AADD[''Barcode1'']-----</span> 5'
     3' <span style="color:blue">-----'''''DDDDDDDD'''''[''Barcode2'']-----</span>|<span style="color:red">CC-----[Barcode1]HHTT-----</span><u>TG</u>|A'''-----'''|<u>TCA</u><span style="color:blue">-----AADD[''Barcode1'']-----</span> 5'
   
   
             |
             |
             V
             V
   
   
  <u>Bisulfite conversion</u>
  <u>Bisulfite conversion</u> (C->U)
   
   
             |
             |
Line 61: Line 61:
   P7: 5' CAAGCAGAAGACGGCATACGAGAT 3'
   P7: 5' CAAGCAGAAGACGGCATACGAGAT 3'
   
   
       5' <span style="color:blue">-----[''Barcode1'']''DD''AA-----T</span>|'''-----'''A|<span style="color:red">-----TTHH[Barcode1]-----CC</span>|<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''----- 3'</span>
       5' <span style="color:blue">-----[''Barcode1'']''DD''AA-----</span><u>AUT</u>|'''-----'''A|<u>GT</u><span style="color:red">-----TTHH[Barcode1]-----UU</span>|<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''----- 3'</span>
         ------------------------------------------------------------------------------ 3' <-----
         ---------------------------------------------------------------------------------- 3' <-----
         -----> 3'                                                                               \
         -----> 3'                                                                                   \
         /                                                                                         P7 5'
         /                                                                                             P7 5'
   5' P5
   5' P5
   
   
                                                                                                  P5
                                                                                                    P5
   5' P7                                                                                         /
   5' P7                                                                                           /
       \                                                                                   <-----
       \                                                                                     <-----
         -----> 3' -------------------------------------------------------------------------------
         -----> 3' ----------------------------------------------------------------------------------
     3' <span style="color:blue">-----'''''DDDDDDDD'''''[''Barcode2'']-----</span>|<span style="color:red">CC-----[Barcode1]HHTT-----</span>|A'''-----'''|<span style="color:blue">T-----AA''DD''[''Barcode1'']----- 5' </span>
     3' <span style="color:blue">-----'''''DDDDDDDD'''''[''Barcode2'']-----</span>|<span style="color:red">UU-----[Barcode1]HHTT-----</span><u>TG</u>|A'''-----'''|<u>TUA</u><span style="color:blue">-----AA''DD''[''Barcode1'']----- 5' </span>
   
   
             |
             |
Line 77: Line 77:
   
   
  <u>PCR Product</u>
  <u>PCR Product</u>
  5' P5<span style="color:blue">-----[''Barcode1'']''DD''AA-----T</span>|'''-----'''A|<span style="color:red">-----TTHH[Barcode1]-----CC</span>|<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span>P7 3'
  5' P5<span style="color:blue">-----[''Barcode1'']''DD''AA-----</span><u>AAT</u>|'''-----'''A|<u>GT</u><span style="color:red">-----TTHH[Barcode1]-----AA</span>|<span style="color:blue">-----[''Barcode2'']'''''DDDDDDDD'''''-----</span>P7 3'
       ----->            ----->                                   ----->
       ----->            ----->                                       ----->
       Index2 Primer      Read1 Primer                             Index2 Primer
       Index2 Primer      Read1 Primer                                 Index2 Primer


==Potential Filler Sequences (noG's)==
==Potential Filler Sequences (noG's)==
Line 94: Line 94:
  CCATTCTCCACTCCACCACACC  58.6              59.9                  Pass
  CCATTCTCCACTCCACCACACC  58.6              59.9                  Pass
  TTCCCATCTCTACTCTCCTCCC  56.7                                    There are more than 3G's or C's in the last 5 bases
  TTCCCATCTCTACTCTCCTCCC  56.7                                    There are more than 3G's or C's in the last 5 bases
  CCTCACCCCTCTTTCCATACAC  56.7              57.1                  Pass
  <u>CCTCACCCCTCTTTCCATACAC  56.7              57.1                  Pass</u>
  CCACCCCATTAAACCCACCAAC  56.7              58.6                  Pass
  <u>CCACCCCATTAAACCCACCAAC  56.7              58.6                  Pass</u>
  CCCAACCAAAACATCCCCCTCC  58.6                                    There are more than 3G's or C's in the last 5 bases
  CCCAACCAAAACATCCCCCTCC  58.6                                    There are more than 3G's or C's in the last 5 bases
  CCCTTTTCCCACCCTTCTCCCA  58.6              61.3                  Pass
  CCCTTTTCCCACCCTTCTCCCA  58.6              61.3                  Pass
Line 102: Line 102:
  CACCCTCCTTCTACCTAAACCC  56.7              56.6                  Pass
  CACCCTCCTTCTACCTAAACCC  56.7              56.6                  Pass
  TTACTTCCCCACCACCCACCCT  58.6              62.5                  Pass
  TTACTTCCCCACCACCCACCCT  58.6              62.5                  Pass
  CCATTTCCTCACTCCCACCCAA  56.7              59.3                  Pass
  <u>CCATTTCCTCACTCCCACCCAA  56.7              59.3                  Pass</u>
  CACACTCCACCTCTTCCCCCTT  58.6                                    Contains runs of C's
  CACACTCCACCTCTTCCCCCTT  58.6                                    Contains runs of C's
  CCCCAAATCCTCCCCTTCTACC  58.6              59.2                  Pass
  CCCCAAATCCTCCCCTTCTACC  58.6              59.2                  Pass
Line 112: Line 112:
  ACCACCATCTCCATCCTCCACC  58.6                                    There are more than 3G's or C's in the last 5 bases
  ACCACCATCTCCATCCTCCACC  58.6                                    There are more than 3G's or C's in the last 5 bases
  ACCCAACCACTCTCACCCCTCT  58.6              62.2                  Pass
  ACCCAACCACTCTCACCCCTCT  58.6              62.2                  Pass
  CCACCTCTTTCCCTCCTCAACC  58.6              59.4                  Pass
  <u>CCACCTCTTTCCCTCCTCAACC  58.6              59.4                  Pass</u>
  TACCCCCTCTCCACACACATAC  56.7                                    Contains runs of C's
  TACCCCCTCTCCACACACATAC  56.7                                    Contains runs of C's
  CCTTCCTCCTCCACATCTTCCC  58.6              59                    Pass
  CCTTCCTCCTCCACATCTTCCC  58.6              59                    Pass
Line 120: Line 120:
  CCACTTAAATCCTCCCCCCACA  56.7                                    Contains runs of C's
  CCACTTAAATCCTCCCCCCACA  56.7                                    Contains runs of C's


==Barcode 1 Adapter Design (Adpt1_v4)==
*We want to modify Adapter 1 by keeping the same T-tail and CC-tail, but adjusting the filler sequences to correctly either have noC's or noG's.  In addition, we want to be able to test whether we can adequately form dsDNA Adpt1_v4 by second strand synthesis and HpyCH4III restriction enzyme digestion.  The steps for dsDNA Adpt1_v4 formation are outlined below:
<u>'''Order the following oligos:'''</u>
Adpt1_v4:          5' -----<u>ACA|GT</u><span style="color:red">-----TTHH[Barcode1]-----CC</span> 3'
Adpt1_v4_primer:                                3' <span style="color:blue">-----</span> 5'
<u>'''Perform second strand synthesis:'''</u>
5' -----<u>ACA|GT</u><span style="color:red">-----TTHH[Barcode1]-----CC</span> 3'
3' -----<u>TG|TCA</u><span style="color:blue">-----AADD[''Barcode1'']<----</span> 5'
<u>'''HpyCH4III RE digestion'''</u>
5'  <u>GT</u><span style="color:red">-----TTHH[Barcode1]-----CC</span> 3'
3' <u>TCA</u><span style="color:blue">-----AADD[''Barcode1'']<----</span> 5' (NOTE: Because we needed to add the restriction enzyme cut site, we see that there is an extra CA prior to the T overhang, which shouldn't affect primers that we design, but there is now a C we must account for.  I added the additional CA sequence above)
*Consequently, we want to order the following adapters:
Adpt1_v4:            5' TCACC<u>ACA|GT</u><span style="color:red">CCTCACCCCTCTTTCCATACAC'''TTAC'''[ACCTC]CCACCCCATTAAACCCACCAAC'''CC'''</span> 3' (NOTE: Must order Adpt1_v4 at 100nm because it is >60bp)
Adpt1_v4_primer:    5' <span style="color:blue">GTTGGTGGGTTTAATGGGGTGG</span> 3'
===Adpt1_v4 Prep===
*We want to use a similar protocol as <http://www.nature.com/nprot/journal/v9/n11/box/nprot.2014.170_BX1.html> to prep the oligos.  However, since this is only a test round for now, we want to use a smaller amount of oligos as input.  Below is the workflow we will be using:
Anneal oligos
        |
        V
Klenow exo- fill-in
        |
        V
Zymo purification
        |
        V
HpyCH4III digestion
        |
        V
Zymo purification


==Barcode 1 Adapter Design (Adpt1_v4)==
*We want to further modify Adpt1 from Adpt1_v3 (which added the additional CC sticky end for Adpt2 ligation) by changing the Filler 2 sequence such that it does not contain any G's.  The reason for this is because we want the complementary sequence of Filler 2 (which would have C's) to be changed during bisulfite conversion.
*Below is the general design that we want to achieve with Adapter 1 (including the HpyCH4III cut site at the end):
                                      Filler2 (originally Filler 2 sequence was GTCCCTCCTACCCGGCGTTT, but need to change such that no G's)
                                        |                Filler1 (Originally was omitted in Adpt1 because was extraneous, but need to add back in order to form second strand)
                                        |                  |
                                        V                  V
Adpt1_v4:      5' -----<u>ACA|GT</u>-----TTDD[Barcode1]-----CC 3' (RE cut will leave behind the necessary 5Phos group)
Adpt1_v4_comp:  3'  ^                          <-----  5' (Complementary to Filler 1 in order to do second strand synthesis)
                      |
                  Add 5bp flanking region that is enough for RE cut
*We want to ensure melting temperature of sequence is ~56C-60C (ideal temperature of 58C, which matches P5/P7 adapters) with a length of 18-30bp.  Consequently, we want to rerun the primergenerator.py script again to generate more potential sequences (see more information on <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-3-13> and <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-4-28>).  Below are the new parameters we want to set:
**Set the temperature options to: tmoupt=58, tmmin=56, tmmax=60
**Use the noG variant of the script in order to form Filler 2 and Filler 3 (Adpt2)
**Set length parameter (-l, --plength) to 22 in order to compensate for the slightly increased melting temperature
*Below are the potential Filler 1/4 sequences:
                        Tm (C)    Primer Stats Notes (http://www.bioinformatics.org/sms2/pcr_primer_stats.html)
'''<u>GCACACATAGCACGACGCGATT  56.7</u>'''
TTGACTGCTGTGGAGTCGTTCG  56.7
GTACCTCGCCCGTTACCTTCGT  58.6      Warning: There are more than 3 self-annealing bases
GTTGGGCCGACACACTTGAGAA  56.7
TGAGGCTCACTATGCGATCCTC  56.7      Warning: There are more than 3 self-annealing bases; There are more than 3 hairpin bases
AAGTGCGGACCCCCAATGCATC  58.6      Warning: There are more than 3 self-annealing bases
GTGGGTCGACAAAGCATCCCCT  58.6      Warning; There are more than 3 Gs or Cs in the last 5 bases
GTGTCTGCCACTGCCTCTCTTT  56.7
TAGCCGACTGGGAAGTCCCCAT  58.6      Warning: There are more than 3 self-annealing bases; There are more than 3 hairpin bases
GGCCTACGACTACTGTCTGCGA  58.6      Warning: There are more than 3 self-annealing bases (Also contains the HpyCH4III cut site in sequence)
*Below are the potential Filler 2/3 (noG) sequences:
                        Tm (C)    Primer Stats Notes
CATCTCCACTACCCCCCAACCT  58.6      Warning: Contains run of C's
TTCACCTCACCTTACCACCCCC  58.6      Warning: Contains run of C's; There are more than 3 G's or C's in the last 5 bases
'''<u>CAACCTCCACCTCACTCTCCTC  58.6</u>'''
TCCATCTTCCCACCCATCTCCC  58.6      Warning: Contains run of C's; There are more than 3 G's or C's in the last 5 bases
CCCCACACTCCCCCAAAACCAA  58.6      Warning: Contains run of C's
TCCCCCCCCTCATACTCACTTC  58.6      Warning: Contains run of C's
TCCCCCCCTCAACTCAACACTC  58.6      Warning: Contains run of C's
TCCACACAACCCCCCAACCTCT  58.6      Warning: Contains run of C's
'''<u>TCCCTCCCATTATCTCCACCCT  56.7</u>'''
ATTACATCCACCCCCCTCACTC  56.7      Warning: Contains run of C's
*Consequently, using the above Filler 1/2 sequences, we can make the necessary Adapter 1 oligos as follows: (using a set Barcode 1 [AGGTG] and DD [AG] sequence)
                                      Filler2 (originally Filler 2 sequence was GTCCCTCCTACCCGGCGTTT, but need to change such that no G's)
                                        |                                Filler1 (Originally was omitted in Adpt1 because was extraneous, but need to add back in order to form second strand)
                                        |                                  |
                                        V                                  V
Adpt1_v4:      5' GTTCG<u>ACA|GT'''GCACACATAGCACGACGCGATTTT'''</u>AG[AGGTG]<u>'''CAACCTCCACCTCACTCTCCTC'''</u>CC 3'
                      ^
                      |
                  Add 5bp flanking region that is enough for RE cut (just choose a random sequence that will be cut off anyways)
Adpt1_v4_comp:  5' GAGGAGAGTGAGGTGGAGGTTG 3' (Complementary to Filler 1 in order to do second strand synthesis)
==Barcode 2 Adapter Design (Adpt2_v3)==
==Barcode 2 Adapter Design (Adpt2_v3)==
*We want to again further modify Adpt2_v2 (which was previously designed to use the ligation method) by using the following:
*We next want to modify Adapter 2 such that we can likewise form the dsDNA Adapter 2 using second strand synthesis.  In addition, we must follow the same noC's/noG's restrictions on filler sequences as outlined above.  The steps for dsDNA Adpt2_v3 formation are outlined below:
**Change Filler 3 sequence such that it contains no G's (otherwise, the complement would contain C's that may be converted during bisulfite conversion. This would confound PCR off of the filler sequence)
<u>'''Order the following oligos:'''</u>
**Add a Filler 4 sequence that will be used to form the second strand to create dsDNA Adapter 2 sequences (we will use the above
Adpt2_v3_primer:     5' /5Phos/<span style="color:blue">-----</span> 3'
Adpt2_v3:            3'     <span style="color:red">GG-----[Barcode2]'''HHHHHHHH'''-----</span> 5
<u>'''Perform second strand synthesis:'''</u>
5' /5Phos/<span style="color:blue">---->[''Barcode2'']''DDDDDDDD''-----</span> 3'
  3'      <span style="color:red">GG-----[Barcode2]'''HHHHHHHH'''-----</span> 5
*Consequently, we want to order the following adapters:
Adpt2_v3_primer:    5' /5Phos/<span style="color:blue">GGTAAAGGAGTGAGGGTGGGTT</span> 3'
Adpt2_v3:            5' <span style="color:red">CCAACTCCTCCCTTTCTCCACC'''CCTCTCCA'''[CCTATC]AACCCACCCTCACTCCTTTACC</span><u>GG</u> 3' (NOTE: We can still order 25nm amount from IDT since oligo is exaclty 60bp long)

Latest revision as of 19:25, 19 June 2017

sci-Methyl Seq Barcode 1 Design v4; Barcode 2 Design v3[edit]

Background[edit]

  • Just yesterday, we designed new sci-Methyl Seq Adapter 1 and Adapter 2 sequences and ordered them to test whether we could ligate on Adapter 2 instead of using the current annealing method. However, looking further into the protocol, it would be prudent to begin designing Adapter 1 such that it will be appropriate for bisulfite conversion and PCR. In order to do this, we need to do the following:
    • Adjust Filler 2 such that it does not contain any G's, which would result in C's in the final sequence that may be bisulfite converted (making PCR inefficient/impossible as primers need a consistent binding site for adding the P5/P7 adapter regions)
    • Begin testing the formation of dsDNA Adpt1/Adpt2. This would require using a method similar to the HpyCH4III digestion outlined here <http://www.nature.com/nprot/journal/v9/n11/box/nprot.2014.170_BX1.html> to create the T-tailed Adpt1. dsDNA Adpt2 can be created just by using polymerization/end-repair.
    • Create final PCR primers that will add the P5/P7 sequencing adapters to both ends of the DNA fragment

Overview[edit]

End Repair/dA-Tailing
     5'  -----A 3'
     3' A-----  5'

           |
           V

Add Adpt1_v4:     5' /5Phos/GT-----TTHH[Barcode1]-----CC 3'
                  3'       TCA-----AADD[Barcode1]----- 5'

           |
           V

Ligate Adpt1_v4 (using same optimized ligation protocol as before)
     5'   -----[Barcode1]DDAA-----ACT|-----A|GT-----TTHH[Barcode1]-----CC 3'
     3' CC-----[Barcode1]HHTT-----TG|A-----|TCA-----AADD[Barcode1]----- 5'

           |
           V

Add Adpt2_v3:     5' /5Phos/-----[Barcode2]DDDDDDDD----- 3'
                  3'      GG-----[Barcode2]HHHHHHHH----- 5'

           |
           V

Ligate Adpt2_v3 (using same optimized ligation protocol as before)
                                     Nick
                                      V
     5' -----HHHHHHHH[Barcode2]-----GG|-----[Barcode1]DDAA-----ACT|-----A|GT-----TTHH[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3'
     3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]HHTT-----TG|A-----|TCA-----AADD[Barcode1]-----|GG-----[Barcode2]HHHHHHHH----- 5'
                                                                                                    ^
                                                                                                   Nick

           |
           V

Denature/separate fragments (will break up DNA at nicks)
                                   5' -----[Barcode1]DDAA-----ACT|-----A|GT-----TTHH[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3'

    3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]HHTT-----TG|A-----|TCA-----AADD[Barcode1]----- 5'

           |
           V

Bisulfite conversion (C->U)

           |
           V

PCR (P7 will be added first followed by P5)
 P5: 5' AATGATACGGCGACCACCGA 3'
 P7: 5' CAAGCAGAAGACGGCATACGAGAT 3'

     5' -----[Barcode1]DDAA-----AUT|-----A|GT-----TTHH[Barcode1]-----UU|-----[Barcode2]DDDDDDDD----- 3'
        ---------------------------------------------------------------------------------- 3' <-----
        -----> 3'                                                                                   \
       /                                                                                             P7 5'
  5' P5

                                                                                                    P5
  5' P7                                                                                            /
      \                                                                                      <-----
       -----> 3' ----------------------------------------------------------------------------------
    3' -----DDDDDDDD[Barcode2]-----|UU-----[Barcode1]HHTT-----TG|A-----|TUA-----AADD[Barcode1]----- 5' 

           |
           V

PCR Product
5' P5-----[Barcode1]DDAA-----AAT|-----A|GT-----TTHH[Barcode1]-----AA|-----[Barcode2]DDDDDDDD-----P7 3'
     ----->             ----->                                       ----->
     Index2 Primer      Read1 Primer                                 Index2 Primer

Potential Filler Sequences (noG's)[edit]

                        Tm(Py Script)     Tm(Oligo Analyzer)     Primer Stats Notes (http://www.bioinformatics.org/sms2/pcr_primer_stats.html)
CCCACTATCATCTACCCTCACC  56.7              56.2                   Pass
ACTCCATCCCTCCACCCCTATC  58.6              59.9                   Pass
CCACTCCACCACTCCTCACCTA  58.6              60.1                   Pass
CCATTCTCCACTCCACCACACC  58.6              59.9                   Pass
TTCCCATCTCTACTCTCCTCCC  56.7                                     There are more than 3G's or C's in the last 5 bases
CCTCACCCCTCTTTCCATACAC  56.7              57.1                   Pass
CCACCCCATTAAACCCACCAAC  56.7              58.6                   Pass
CCCAACCAAAACATCCCCCTCC  58.6                                     There are more than 3G's or C's in the last 5 bases
CCCTTTTCCCACCCTTCTCCCA  58.6              61.3                   Pass
CTCACTTCTCTCACCTACTCCC  56.7                                     There are more than 3G's or C's in the last 5 bases
AACCCCTCATTACAACCCCCCC  58.6                                     Contains runs of C's; There are more than 3G's or C's in the last 5 bases
CACCCTCCTTCTACCTAAACCC  56.7              56.6                   Pass
TTACTTCCCCACCACCCACCCT  58.6              62.5                   Pass
CCATTTCCTCACTCCCACCCAA  56.7              59.3                   Pass
CACACTCCACCTCTTCCCCCTT  58.6                                     Contains runs of C's
CCCCAAATCCTCCCCTTCTACC  58.6              59.2                   Pass
TATCCTCCCCCATTCCTCCTCA  56.7                                     Contains runs of C's
CTAACCCATCCCCCTTCCACTA  56.7                                     Contains runs of C's
ACCCCCTACTCCACCCACATTT  56.7                                     Contains runs of C's
TATCTCTCCCCCACCCTACCTA  56.7                                     Contains runs of C's
CCCCCACAATCACCACAACTCC  58.6                                     Contains runs of C's
ACCACCATCTCCATCCTCCACC  58.6                                     There are more than 3G's or C's in the last 5 bases
ACCCAACCACTCTCACCCCTCT  58.6              62.2                   Pass
CCACCTCTTTCCCTCCTCAACC  58.6              59.4                   Pass
TACCCCCTCTCCACACACATAC  56.7                                     Contains runs of C's
CCTTCCTCCTCCACATCTTCCC  58.6              59                     Pass
TCCCCTATCACCCCCAACTTCT  56.7                                     Contains runs of C's
CCCTACCCCTCCACCTCAATCA  58.6              60.3                   Pass
CCCTCTCCACACCATTCTTACC  56.7              57.1                   Pass
CCACTTAAATCCTCCCCCCACA  56.7                                     Contains runs of C's

Barcode 1 Adapter Design (Adpt1_v4)[edit]

  • We want to modify Adapter 1 by keeping the same T-tail and CC-tail, but adjusting the filler sequences to correctly either have noC's or noG's. In addition, we want to be able to test whether we can adequately form dsDNA Adpt1_v4 by second strand synthesis and HpyCH4III restriction enzyme digestion. The steps for dsDNA Adpt1_v4 formation are outlined below:
Order the following oligos:
Adpt1_v4:          5' -----ACA|GT-----TTHH[Barcode1]-----CC 3'
Adpt1_v4_primer:                                 3' ----- 5'

Perform second strand synthesis:
5' -----ACA|GT-----TTHH[Barcode1]-----CC 3'
3' -----TG|TCA-----AADD[Barcode1]<---- 5'

HpyCH4III RE digestion
5'  GT-----TTHH[Barcode1]-----CC 3'
3' TCA-----AADD[Barcode1]<---- 5' (NOTE: Because we needed to add the restriction enzyme cut site, we see that there is an extra CA prior to the T overhang, which shouldn't affect primers that we design, but there is now a C we must account for.  I added the additional CA sequence above)
  • Consequently, we want to order the following adapters:
Adpt1_v4:            5' TCACCACA|GTCCTCACCCCTCTTTCCATACACTTAC[ACCTC]CCACCCCATTAAACCCACCAACCC 3' (NOTE: Must order Adpt1_v4 at 100nm because it is >60bp)
Adpt1_v4_primer:     5' GTTGGTGGGTTTAATGGGGTGG 3'

Adpt1_v4 Prep[edit]

Anneal oligos
       |
       V
Klenow exo- fill-in
       |
       V
Zymo purification
       |
       V
HpyCH4III digestion
       |
       V
Zymo purification

Barcode 2 Adapter Design (Adpt2_v3)[edit]

  • We next want to modify Adapter 2 such that we can likewise form the dsDNA Adapter 2 using second strand synthesis. In addition, we must follow the same noC's/noG's restrictions on filler sequences as outlined above. The steps for dsDNA Adpt2_v3 formation are outlined below:
Order the following oligos:
Adpt2_v3_primer:     5' /5Phos/----- 3'
Adpt2_v3:            3'      GG-----[Barcode2]HHHHHHHH----- 5

Perform second strand synthesis:
5' /5Phos/---->[Barcode2]DDDDDDDD----- 3'
3'      GG-----[Barcode2]HHHHHHHH----- 5
  • Consequently, we want to order the following adapters:
Adpt2_v3_primer:     5' /5Phos/GGTAAAGGAGTGAGGGTGGGTT 3'
Adpt2_v3:            5' CCAACTCCTCCCTTTCTCCACCCCTCTCCA[CCTATC]AACCCACCCTCACTCCTTTACCGG 3' (NOTE: We can still order 25nm amount from IDT since oligo is exaclty 60bp long)