AlanFung:LabNotes/DNA/2009-8-18: Difference between revisions
Jump to navigation
Jump to search
>Alan6017518 |
>Alan6017518 |
||
Line 26: | Line 26: | ||
37C 2h. | 37C 2h. | ||
*Qiaquick column purification. Elute in 12ul EB. | *Qiaquick column purification. Elute in 12ul EB. | ||
===quantification with qPCR=== | |||
I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM. | |||
I dilute the Parkinson's lib with 1:10 ratio. | |||
Syb_FP5: ATGATACGGCGACCACCGAG | |||
Syb_RP7: CAAGCAGAAGACGGCATACGAG | |||
x 14 | |||
Template 1ul | |||
2x iProof mix 25ul 350 | |||
syb_RP7 (100uM) 0.2ul | |||
Syb_FP5 (100uM) 0.2ul | |||
H2O 24ul | |||
50X SYBG I 0.2ul | |||
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold. |
Revision as of 22:32, 18 August 2009
Digestion with MmeI
PGP4 | PGP6 | PGP10 | A | B | |
Sample | 20 | 20 | 20 | 10 | 10 |
10X NEBuffer 4 | 4 | 4 | 4 | 3 | 3 |
1mM SAM (fresh) | 8 | 8 | 8 | 6 | 6 |
2U/ul MmeI | 1 | 1 | 1 | 1 | 1 |
ddH20 | 7 | 7 | 7 | 10 | 10 |
Total | 40 | 40 | 40 | 30 | 30 |
1mM SAM: 32mM SAM 1ul + 31ul ddH2O. 37C 2h.
- Qiaquick column purification. Elute in 12ul EB.
quantification with qPCR
I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM. I dilute the Parkinson's lib with 1:10 ratio. Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG x 14 Template 1ul 2x iProof mix 25ul 350 syb_RP7 (100uM) 0.2ul Syb_FP5 (100uM) 0.2ul H2O 24ul 50X SYBG I 0.2ul
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.