Alice:LabNotes/2010-3-8: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Zsakura2
>Zsakura2
Line 84: Line 84:
  DF6-9-9: 221ng/ul (5ul needed)
  DF6-9-9: 221ng/ul (5ul needed)
  foreskin: 153ng/ul (6.5ul needed)
  foreskin: 153ng/ul (6.5ul needed)
CViB: 48.7ng/ul (20.5ul needed)
CViF: 77.7ng/ul (13ul needed)


  exome probe (with Jan09 1-5,8,9,Mar R2, R3): 7ng/ul (14ul needed)
  exome probe (with Jan09 1-5,8,9,Mar R2, R3): 7ng/ul (14ul needed)

Revision as of 15:41, 9 March 2010

Prepare genomic DNA for hybridization

  • samples to be prepared: CVF-gDNA, CViB-gDNA,
  • two sheared gDNA received from Harvard: CD1 PGP1 ips P16 and PGP1F 8 gDNA

End-repair Reactions

Fragmented DNA                             85 ul
10X End Repair Reaction Buffer             10 ul
End Repair Enzyme Mix                      5  ul
Keep the tube at room temperature (~20°C) for 30 minutes.
Purify with Qiaquick column and elute in 40ul ddH2O
Note: for blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the
chance of getting chimeric reads.


A-Tailing reactions

Blunt-end DNA                             37 ul
10X dA-Tailing Reaction Buffer (10X)       5 ul
Klenow Fragment (3’-5’ exo-)               3 ul
H2O                                        5 ul
Incubated at 37C for 30min
purified the products with Qiaquick column and elute in 40ul ddH2O

adaptor ligation

Prepare adaptors (need to be done only for the first time): 
100uM PE-t: 20ul
100uM PE-b: 20ul
10x stoffel buffer:  10ul
H2O:        50ul
94C for 3 min, and then cool down to 20C at the rate of 0.1C/sec. 
commonly used adaptors:
Blunt-end adaptors:
5’NH2- ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’OH	 	Solexa_1_up
3’NH2-ATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-5’OH	        Solexa_1_lo_nop

TA adaptors (for the one adaptor protocol):
5- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3’OH		PE_t_adapter
3-CTTCTGCCGTATGCTCGAGAAGGCTAG-5’Phos	                t_adaptor_rc_s

regular Y adaptor:
PE_t_adaptor(top)              ACACTCTTTCCCTACACGACGCTCTTCCGATC*T              3'-Phosphorothioate bond	
PE_b_adaptor(bottom)           \\5phos\\GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG       5'-phosphorylation	
Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw 
cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time. 
adaptor:target molar ratio is 1:10~20
A-tailed DNA                               10 ul
20uM Y adaptor                             3 ul 
5X Quick ligase buffer                     10 ul  
Quick Ligase                                3 ul
H2O                                        24 ul                                                 
Incubate at room temperature for 15 minutes
purify the product with Agencourt AMpure kit and elute in 40ul ddH2O

PCR

Ligation products                 5ul      (8 well for each set, total of 80 well) 
100uM Solexa_PCR_up               0.2ul        
100uM solexa_PCR-lo               0.2ul
2X phusion HF master mix          50ul     
50X SYBR Green I                  0.4ul      
H2O                               45ul       
PCR program: 98 °C 30sec  -> 13 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold. 
purify the products with Qiagen Qiaquick columns and elute in 40ul ddH2O

Biotin-labeled probe capture

  • gDNA samples of DF and foreskin will be used, and the preparation protocol can be found under labnote 2-1-2010

working buffer preparation

1x binding buffer (following Nimblegen setup):
1M NaCl: 1000ul
10mM Tris-HCl (pH ~7): 25ul
1mM EDTA: 5ul
ddH2O: 1470ul
total: 2.5ml

Hybrid selection

Mix the following to 20ul total volume: 
1ug ligated DNA with 100ng padlock probes
2.5ug of human Cot-1 DNA
2ul of 10X AmpLigase buffer
1ul of 100uM competing oligos each (Solexa_up and Solexa_lo)
[gDNA]
DF6-9-9: 221ng/ul (5ul needed)
foreskin: 153ng/ul (6.5ul needed)
exome probe (with Jan09 1-5,8,9,Mar R2, R3): 7ng/ul (14ul needed)

system setup (all units are in ul):

reagents DF foreskin
DNA 5 6.5
probe 14 14
10x ampligase buffer 4 4
human Cot-1 DNA 2.5 2.5
Solexa_up (100uM) 1 1
Solexa_lo (100uM) 1 1
ddH2O 2.5 1
total: 30 30
95C 5min -> cool down to 60C at 0.01C/sec -> 60C 24 hours -> 50C 24 hours.

Prepare the Streptavidin Dynabeads

a. Take 50ul M-280 streptavidin Dynalbeads per reaction, place the tube on magnet and remove the liquid when the solution becomes clear
b. add twice the volume of the beads of 1x binding buffer, place the tube on magnet and remove the liquid when the solution becomes clear
c. wash the beads for a total of  3 times with the 1x binding buffer (1M NaCl, 10mM Tris-HCl pH 7.5, 1mM EDTA)
d. resuspend the beads in 200ul 1x binding buffer, warm up to 45C. 
c. Add the 20ul hybridization mix to 200ul M-280 beads, incubate at 45C in the Thermal Mixer at 300rpm for 30 min, take 1/2 and go on with no wash. 
d. Remove the liquid from the beads with a magnet.
e. Perform three 10-min wash with 0.5ml pre-warm 0.1x SSC and 0.1% SDS at 45C.
f. After the final wash, resuspend the beads with 50ul 0.1M NaOH, incubate at RT for 10min.
g. Separate the supernatant from the beads with a magnet, and transfer the supernatant (eluted DNA) to 70ul 1M Tris-HCl, pH 7.5. 
h. Purifythe 120ul neutralized DNA with a Qiaquick column, eluted with 30ul EB.

Post-capture PCR

a.Set up a 400ul reaction with Phusion High-Fidelity PCR master mix:
  2x Phusion master mix:    200ul
  100uM PCR_F		       2ul
  100uM PCR_R		       2ul
  50X SYBG I		     3.2ul
  Captured DNA		      30ul
  H2O 			     163ul
b.Perform real-time PCR with 98C 30s -> 20 x (98C 10s -> 63C 20s-> 72C 20s) -> 72C 2min. 
Terminate the reaction when the amplification curves approach to the plateau. 

Measurement of Enrichment using qPCR on biotin-labeled probe capture sample

  • The qPCR assay is used to estimate relative fold-enrichment by measuring the relative abundance of control targets in amplified sample library and amplified captured DNA to determine whether the capture was successful.

Preparation

NSC qPCR assay name primer sequence 5'->3' Tm ( C) length
NSC-0237 F: CGCATTCCTCATCCCAGTATG 81.15 80bp
R: AAAGGACTTGGTGCAGAGTTCAG
NSC-0247 F: CCCACCGCCTTCGACAT 81.03 74bp
R: CCTGCTTACTGTGGGCTCTTG
NSC-0268 F: CTCGCTTAACCAGACTCATCTACTGT 78.99 75bp
R: ACTTGGCTCAGCTGTATGAAGGT
NSC-0272 F: CAGCCCCAGCTCAGGTACAG 82.23 71bp
R: ATGATGCGAGTGCTGATGATG
  1. Dilute the NSC assay forward and reverse primers to 2μM.
  2. Dilute sufficient amounts of amplified sample library and amplified captured DNA to a concentration of 5ng/μl in PCR grade water for use as qPCR templates

PCR amplification

PCR grade water    19.7ul
NSC Assay forward primer (2uM)    1ul
NSC Assay reverce priimer (2uM)   1ul
SYBR Green (50X)                  1ul
template (5ng/ul)          3.3ul
KAPA 2x master mix       25ul
95C 3min -> (95C 3sec -> 60C 20sec -> 72C 3sec) x40 -> 72C 3min -> 15C hold