Rui:DNAseq analysis on Hiseq120313: Difference between revisions
Jump to navigation
Jump to search
>RuiLiu m (→Validation) |
>RuiLiu m (→Validation) |
||
Line 100: | Line 100: | ||
|- | |- | ||
| aliquot||||||||||||||B2_Indx80,B2_Indx82,B3_Indx92|| | | aliquot||||||||||||||B2_Indx80,B2_Indx82,B3_Indx92|| | ||
|} | |||
{| {{table}} border=1 | |||
| align="center" style="background:#f0f0f0;"|'''PCR-ID''' | |||
| align="center" style="background:#f0f0f0;"|'''Gene''' | |||
| align="center" style="background:#f0f0f0;"|'''Cat.''' | |||
| align="center" style="background:#f0f0f0;"|'''chr''' | |||
| align="center" style="background:#f0f0f0;"|'''pos''' | |||
| align="center" style="background:#f0f0f0;"|'''refBase''' | |||
| align="center" style="background:#f0f0f0;"|'''B2B3(GT)''' | |||
| align="center" style="background:#f0f0f0;"|'''Primers''' | |||
| align="center" style="background:#f0f0f0;"|'''PCR''' | |||
|- | |||
| SNC3||PPP1R9A (This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.)||exon||7||94918006||G||A=3/G=6|| AGTGTGCAGCAGGTTTCTCA||223 | |||
|- | |||
| |||||||||||||| CCTCTCAGATATGCAGAATGCTC||>chr7:94917911+94918133 | |||
|- | |||
| QC good||Fib||P30||B2||B3||B2_MDA||B3_MDA|||| | |||
|- | |||
| PCR|||||||||||||||| | |||
|- | |||
| seq. ID||RL17||RL18||RL19||RL20||RL21||RL22|||| | |||
|- | |||
| seq. length||184||270||846, chimeric||1K, chimeric||198||1K|||| | |||
|- | |||
| blast||94917950 94918133||94917950 94918132||94917950 94918133||94917951 94918133||94917949 94918133|||||| | |||
|- | |||
| identity||100%||100%|||||||||||| | |||
|- | |||
| SNC||G||G||G||G||G||chr1|||| | |||
|- | |||
| aliquot||||||||||||all B3||B3_Indx82,B3_Indx95,B3_Indx96|| | |||
|} | |} |
Revision as of 09:08, 27 April 2012
Hiseq_120313
Sample preparation
Flow cell
- s1-2: RL_B2_23s_Mar8.2012
- s5-6: RL_B3_24s_Mar8.2012
- s7-8: RL_Fib-Bulk_Mar8.2012
Mapping
- fastq
Genome-miner: /media/SeqStore2/120315_HiSeq/Genome Triton: /projects/zhang-lab/seqStore/120313_HiSeq/Genome
- prepare to submit jobs in triton
info file: File:B2 Indx73.info.txt job file: File:B2 Indx73.job.txt
- An unique name for each library/index
- Excel or plain text for info/job files, tab-delimited plain text
- upload to triton (attn: space/line problems in nano format)
- tr "/r" "/n" < info.txt > info (convert to unix format)
- sed "s/73/xx/g" < 73.info > xx.info (convert to other index)
- qsub xx.job
- qstat | grep rul (check running status)
- qdel xxxx (kill job)
- triton contact info: Jim Hayes <jhayes@sdsc.edu> [2]
- following analysis
[3]
Validation
- multiple bands / unknown sequence in PCR results -> confirm primers on gDNA
- negative SNCs -> positive aliquot PCR
PCR-ID | Gene | Cat. | chr | pos | refBase | B2B3(GT) | Pf | Pr | PCR | ' |
SNC1 | GLT25D2 (glycosyltransferase 25 domain containing 2) | exon | 1 | 183907978 | G | G=7/T=3 | CAGGGAGCCTTCATAGCTCA | ACCTGAGTGACACGGAGACC | 189bp | >chr1:183907885+183908073 |
QC good | Fib | P30 | B2 | B3 | B2_MDA | B3_MDA | ||||
PCR | 1 band | 1 band | ||||||||
seq. ID | RL01_R | RL02 | RL03 | RL04 | RL05 | RL06 | ||||
seq. length | 350 | 160 | 160 | 160 | 160 | 70 | ||||
blast | 183907925 183908073 | 183907925 183908071 | 183907932 183908074 | 183907932 183908074 | 183907930 183908071 | 183907997 183908070 | ||||
identity | 100% | 100% | 100% | 100% | 100% | 100% | ||||
SNC | G | G | G | G | G (T? C?) | N/A | ||||
aliquot | B2_Indx80,B2_Indx93,B3_Indx93 |
PCR-ID | Gene | Cat. | chr | pos | refBase | B2B3(GT) | Primers | PCR |
SNC2 | FLNB (actin binding protein 278) | exon | 3 | 58104657 | C | C=6/G=3 | TTTGGTACCCAAAGGTAAACTGA | 191 |
CAACCCATCTGCTCTCCATT | >chr3:58104557+58104747 | |||||||
failed, repeat | Fib | P30 | B2 | B3 | B2_MDA | B3_MDA | ||
PCR | ||||||||
seq. ID | RL09 | RL10_R | RL11_R | RL12 | RL13 | RL14 | ||
seq. length | 141 | 330 | 141 | 170 | 70 | |||
blast | 183907930 183908070 | 58104610 58104747 | 58104607 58104747 | 183907950 183908060 | 183907997 183908061 | |||
identity | 98% | 100% | 100% | 94% | ||||
SNC | SNC1? T? | C | C | SNC1? T? | no match | SNC1? N/A | ||
aliquot | B2_Indx80,B2_Indx82,B3_Indx92 |
PCR-ID | Gene | Cat. | chr | pos | refBase | B2B3(GT) | Primers | PCR |
SNC3 | PPP1R9A (This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.) | exon | 7 | 94918006 | G | A=3/G=6 | AGTGTGCAGCAGGTTTCTCA | 223 |
CCTCTCAGATATGCAGAATGCTC | >chr7:94917911+94918133 | |||||||
QC good | Fib | P30 | B2 | B3 | B2_MDA | B3_MDA | ||
PCR | ||||||||
seq. ID | RL17 | RL18 | RL19 | RL20 | RL21 | RL22 | ||
seq. length | 184 | 270 | 846, chimeric | 1K, chimeric | 198 | 1K | ||
blast | 94917950 94918133 | 94917950 94918132 | 94917950 94918133 | 94917951 94918133 | 94917949 94918133 | |||
identity | 100% | 100% | ||||||
SNC | G | G | G | G | G | chr1 | ||
aliquot | all B3 | B3_Indx82,B3_Indx95,B3_Indx96 |