Matt:LabNotes/2013-7-1: Difference between revisions
Jump to navigation
Jump to search
>Mzcai mNo edit summary |
>Mzcai mNo edit summary |
||
Line 31: | Line 31: | ||
{| {{table}} border = 1 | {| {{table}} border = 1 | ||
| align="center" style="background:#f0f0f0;"|'''Components''' | | align="center" style="background:#f0f0f0;"|'''Components''' | ||
| align="center" style="background:#f0f0f0;"|''' | | align="center" style="background:#f0f0f0;"|'''1 rxn''' | ||
| align="center" style="background:#f0f0f0;"|''' | | align="center" style="background:#f0f0f0;"|'''13 rxn''' | ||
|- | |- | ||
| Captured template||12.00||0.00 | | Captured template||12.00||0.00 | ||
Line 38: | Line 38: | ||
| 10uM Forward+Indx||2.00||0.00 | | 10uM Forward+Indx||2.00||0.00 | ||
|- | |- | ||
| 10uM Reverse||2.00|| | | 10uM Reverse||2.00||26.00 | ||
|- | |- | ||
| 2x KAPA SYBG fast MM||50.00|| | | 2x KAPA SYBG fast MM||50.00||650.00 | ||
|- | |- | ||
| H2O||34.00|| | | H2O||34.00||442.00 | ||
|- | |- | ||
| Total||100.00|| | | Total||100.00||1300.00 | ||
|} | |} | ||
Program | Program | ||
*98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold | *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold |
Revision as of 19:57, 1 July 2013
Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-6-28
Amplification with Sequencing Adapters
- Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007)
- Since this is the same design as LC Sciences probes that Noi used, I'll use the same primers
Tube # | Sample | Index# |
1 | NTC-0gap | Indx7 |
2 | gDNA-0gap | Indx45 |
3 | cDNA-0gap | Indx76 |
4 | NTC-20gap | Indx7 |
5 | gDNA-20gap | Indx77 |
6 | cDNA-20gap | Indx78 |
Components | 1 rxn | 13 rxn |
Captured template | 12.00 | 0.00 |
10uM Forward+Indx | 2.00 | 0.00 |
10uM Reverse | 2.00 | 26.00 |
2x KAPA SYBG fast MM | 50.00 | 650.00 |
H2O | 34.00 | 442.00 |
Total | 100.00 | 1300.00 |
Program *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold