Hosuk:LabNotes/2013-12-30: Difference between revisions
Jump to navigation
Jump to search
>Hosuki78 No edit summary |
>Hosuki78 No edit summary |
||
Line 53: | Line 53: | ||
**perim conn: 8 | **perim conn: 8 | ||
**bkgmult lower: 4 | **bkgmult lower: 4 | ||
====Result : RAB7A Target on 1st Rolony==== | |||
*ATTO550-RAB7A on 1st Rolony probes : '''NO signal at all! WHY?''' | |||
**I annealed Cy3 1st Rolony probes : showed the same signals to the previous Cy5 1st Rolony probes… so there are still 1st Rolonies…BUT then why there are no 1st Rolonies with RAB7A targets? |
Latest revision as of 18:31, 10 January 2014
RT primer annealing specific position in mRNA[edit]
Primer Design[edit]
- Target gene : RAB7A
- RAB7A mRNA target sequence: CAGAACTTGGACCTTCTCGCTTCTGTCCTCCGTTTAGTCTCCTC
- This is base 125-177
- Choose primers that are 10bp long while minimizing GC content and ~200bp, ~300bp, ~500bp, and ~1000bp from TSS
- mRNA target of RAB7A 220b distance from TSS : CGCGTTTGAA
- mRNA target of RAB7A 300b distance from TSS : ACTCATGAAC
- mRNA target of RAB7A 510b distance from TSS : CAACACATTC
- mRNA target of RAB7A 1000b distance from TSS: TTACACCCCA
- RT_RAB7A_220b: [/5Phos/TCTCGGGAACGCTGAAGA] + TTCAAACGCG (--> D220)
- RT_RAB7A_300b: [/5Phos/TCTCGGGAACGCTGAAGA] + GTTCATGAGT (--> D300)
- RT_RAB7A_510b: [/5Phos/TCTCGGGAACGCTGAAGA] + GAATGTGTTG (--> D510)
- RT_RAB7A_1000b: [/5Phos/TCTCGGGAACGCTGAAGA] + TGGGGTGTAA(--> D1000)
Rolony Fab.[edit]
- Use 96 well plate (12/28~12/30)
- Control : Random Hexamer
File:PGP1F 96well RTpositionTest Cells 2.png
Result[edit]
- Rolonies from 1000b primer were too many, they are much more than control (random hexamer).
- There is a trend, 220b and 300b primer sample don't have many rolonies which are almost similar number that we've seen so far with RAB7A detection.
- However 500b sample showed more rolonies, and 1000b sample has too many and too much strong signal.
- I'm not sure the signal from 1000b sample is real signal or something other things...because it's too much.
- But since I've made 4 wells per each sample, and all 4 wells have the sample result per each primer, so I think these images shows some meaningful results.
- 1st Rolony Counts
File:PGP1F 96well RTpositionTest 1stRolonyCount.png
- PISA parameters
- Gaussian Std : 3
- Gaussian Upper : -2e-4
- area upper: 50
- area lower: 4
- axratio lower: 0.6
- circ upper: 1.6
- circ lower: 0.8
- perim conn: 8
- bkgmult lower: 4
Result : RAB7A Target on 1st Rolony[edit]
- ATTO550-RAB7A on 1st Rolony probes : NO signal at all! WHY?
- I annealed Cy3 1st Rolony probes : showed the same signals to the previous Cy5 1st Rolony probes… so there are still 1st Rolonies…BUT then why there are no 1st Rolonies with RAB7A targets?