Sam:LabNotes/Microbione/2009-2-3: Difference between revisions
Jump to navigation
Jump to search
>Sam Chiang |
>Sam Chiang |
||
Line 22: | Line 22: | ||
#Using Netprimer[http://www.premierbiosoft.com/netprimer/index.html]to evaluate primer structure. | #Using Netprimer[http://www.premierbiosoft.com/netprimer/index.html]to evaluate primer structure. | ||
#Pick up two primers with differnt size of amplicon. | #Pick up two primers with differnt size of amplicon. | ||
>h18S_211_f | >h18S_211_f | ||
TTGCTGCAGTTAAAAAGCTC | TTGCTGCAGTTAAAAAGCTC | ||
>h18S_211_r | >h18S_211_r | ||
CATTATTCCTAGCTGCGGTA | CATTATTCCTAGCTGCGGTA |
Revision as of 06:47, 9 February 2009
Primer design for human 18S and Bacteria 16S
Objective
Besides the realtime monitoring,
- Design 18S primers for positive control / validation purpose of a successful MDA reaction using human genome template.
- Design 16S primers for positive control / validation purpose of a successful MDA reaction using bacteria genome template.
- These primers could also be used to detect the contamination of exogenus gDNA.
Human S18 primer
- Collect the human S18 cDNA sequence
- Clean the sequcne and mask the inconsistat nucleotide
- Paste the sequence on KZ's Primer3 calculator[1]
- Criteria:
Primer size: Min: 18bp, opt:20 bp, Max: 22bp Product size: ~200 bp; ~300 bp Annealing Temp: Min:57, Opt:58, Max:59
Results
- Using Netprimer[2]to evaluate primer structure.
- Pick up two primers with differnt size of amplicon.
>h18S_211_f TTGCTGCAGTTAAAAAGCTC >h18S_211_r CATTATTCCTAGCTGCGGTA ----------------------------------------------- >h18S_306_f GTACAGTGAAACTGCGAATG >h18S_306_r CGACTACCATCGAAAGTTGA -----------------------------------------------