Noi/NOTES/2014-10-15: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Noi
mNo edit summary
>Noi
mNo edit summary
Line 18: Line 18:
* I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set)
* I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set)
* I will include the two positive control for the two primer set to confirm that the amplification works fine. Note that I combine F & R primer in final conc. 10uM in the same tube.
* I will include the two positive control for the two primer set to confirm that the amplification works fine. Note that I combine F & R primer in final conc. 10uM in the same tube.
  Components         Volume (ul) Final conc.
  '''Components         Volume (ul) Final conc.'''
  Seed oligo (1694.3nM) 0.59         100nM
  Seed oligo (1694.3nM) 0.59         100nM
  F/R primer mix (10uM) 0.40         400nM
  F/R primer mix (10uM) 0.40         400nM
Line 26: Line 26:
* 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 18-> 72C 3min -> 15C hold
* 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 18-> 72C 3min -> 15C hold
* The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification
* The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification
'''Components         Volume (ul)'''
Seed oligo (1694.3nM) 8.85
F primer mix (10uM) 0.60
R primer mix (10uM) 0.60
2x KAPA SYBG fast MM 75.00
H2O 64.95
Total 150.00
* Split each set in 3X50ul
* 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X '''16'''-> 72C 3min -> 15C hold
* Purify the 1st amplicons with 2x QIAquick column and elute with 50ul TE buffer
* Measure concentration by N.D.
* Will add N.D. result.
* I then continue to amplify cancer_hyb_sep14 probe set with the same condition of the quick test for the two subsets above for 16 cycles. The amplification worked fine at 16 cycles.
* I ran all 1st round amplicon in 6% TBE gel

Revision as of 18:40, 17 October 2014

Oligo info.

*Sept14 probe set: Media:90k_oligos_30Sept2014.txt.gz
           probe set           # probes    Length             Amp primers                                               
  Chris    gDNA_MS_v2            8,045      127bp  V6(G*T*CATATCGGTCACTGTU//5Phos/GGGTAGTGTGTATCCTG)      
  Kun      cancer_hyb_sept14    51,639  110-130bp  V8(T*C*TAATCTAGCGCGACGTCU//5Phos/CCACAAGAGGCGCTATG)   
  Kun      LMS_selector         17,342  124-130bp  NE(TGCCTAGGACCGGATCAACT/GCTTCGGTTCACGCAATG)           
  Kun      padlock_SNPs         12,974      125bp  V4(G*A*CTGGAAGAGCACTGTU//5Phos/AGCCTCATGCGTATCCG)         
                         Total  90,000
  • Length: I would use the average size of the oligo pool to calculate concentration ~125nt = MW=41250g/mole
  • Conc. : 69.89 ng/ul = 1694.30 (69.89ng/ul/ 41250g/mole)

Expansion PCR (Quick test, round1)

  • I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set)
  • I will include the two positive control for the two primer set to confirm that the amplification works fine. Note that I combine F & R primer in final conc. 10uM in the same tube.
Components	        Volume (ul)	Final conc.
Seed oligo (1694.3nM)	0.59	        100nM
F/R primer mix (10uM)	0.40	        400nM
2x KAPA SYBG fast MM	5.00	        1x
H2O	                4.01	
Total	               10.00
  • 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 18-> 72C 3min -> 15C hold
  • The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification
Components	        Volume (ul)
Seed oligo (1694.3nM)	8.85
F primer mix (10uM)	0.60
R primer mix (10uM)	0.60
2x KAPA SYBG fast MM	75.00
H2O	64.95
Total	150.00
  • Split each set in 3X50ul
  • 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 16-> 72C 3min -> 15C hold
  • Purify the 1st amplicons with 2x QIAquick column and elute with 50ul TE buffer
  • Measure concentration by N.D.
  • Will add N.D. result.
  • I then continue to amplify cancer_hyb_sep14 probe set with the same condition of the quick test for the two subsets above for 16 cycles. The amplification worked fine at 16 cycles.
  • I ran all 1st round amplicon in 6% TBE gel