Dinh/Dinh 2015/NOTES/2015-1-7: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Dinh
mNo edit summary
>Dinh
Line 109: Line 109:
|}
|}
===SNP matrix===
===SNP matrix===
* Run MasterBisReadMapper with variant calling. Since I already have the sam files to give as input, MasterBisReadMapper will only call SNPs.
* Run MasterBisReadMapper with variant calling. Since I already have the sam files to give as input, MasterBisReadMapper will not need to re-map the data.
* Homozygous SNPs are also called at dbSNP138 positions.
* Homozygous SNPs are also called at dbSNP138 positions.
* After getting the *filtered.SNP.txt files, generate the tped and tfam files for plink.
* After getting the *filtered.SNP.txt files, generate the tped and tfam files for plink.
Line 125: Line 125:
   plot(hclust(as.dist(1-A)), main="plink.mibs")
   plot(hclust(as.dist(1-A)), main="plink.mibs")
   dev.off()
   dev.off()
* SNPs dendrogram:
  [[File:monod_141216_plink_mibs.png | 300px]]

Revision as of 17:32, 30 January 2015

141216_HiSeqRapidRun

  • Processed files are copied to genome-miner at: /media/Ext12T/DD_Ext12T/MONOD/141216_HiSeqRapidRunWGBS
    • Sub-directories: BAMfiles, MethylFreq, BEDfiles
  • Library information from Noi: http://genome-tech.ucsd.edu/LabNotes/index.php/Noi/NOTES/2014-12-25
  • Perform trimming with trim-galore, mapping with bwa mem, overlapping PE are clipped with bamUtils
    • For trimming, use methylated adaptors sequences, quality trim with -q 20 from 3' ends, and trim 5 bp from 5' ends (methylation bias)
  • Do not remove clonal reads
  • Use Hg19_lambda reference (Hg19 plus LambdaDNA fasta files).
  • Use tscc with 4 processors per node

Mapping steps

  • Make a table:
 PC-P_2  /oasis/tscc/scratch/ddiep/Working/150106_HiSeqRapidWGBS/Fastq   s_1_1_ILMN_Indx01.txt,s_1_2_ILMN_Indx01.txt     64      none    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC      AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT      WGBS
 PC-P_4  /oasis/tscc/scratch/ddiep/Working/150106_HiSeqRapidWGBS/Fastq   s_1_1_ILMN_Indx03.txt,s_1_2_ILMN_Indx03.txt     64      none    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC      AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT      WGBS 
 NC-7    /oasis/tscc/scratch/ddiep/Working/150106_HiSeqRapidWGBS/Fastq   s_1_1_ILMN_Indx07.txt,s_1_2_ILMN_Indx07.txt     64      none    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC      AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT      WGBS
 PC-P_9  /oasis/tscc/scratch/ddiep/Working/150106_HiSeqRapidWGBS/Fastq   s_1_1_ILMN_Indx08.txt,s_1_2_ILMN_Indx08.txt     64      none    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC      AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT      WGBS
 6-P-1   /oasis/tscc/scratch/ddiep/Working/150106_HiSeqRapidWGBS/Fastq   s_1_1_ILMN_Indx09.txt,s_1_2_ILMN_Indx09.txt     64      none    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC      AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT      WGBS
 ...
  • Split table file into 27 files, 1 line/sample per file:
 split -l 1 list_my_files aa_
  • Run Go.Map.sh script on tscc, each sample will be processed on a separate node.
    • New script added to simplify BisReadMapper pipeline: MasterBisReadMapper.pl in BisReadMapper_v1.4
#===Change the following paths===#
cur_dir=`pwd`
scripts_dir="/home/ddiep/scripts/BisReadMapper/src"
#===Begin===#
for n in aa_aa aa_ap aa_ab aa_ac aa_ad aa_ae aa_af aa_ag aa_ah aa_ai aa_aj aa_ak aa_al aa_am aa_an aa_ao aa_aq aa_ar aa_as aa_at aa_au aa_av aa_aw aa_ax aa_ay aa_az aa_ba
do
        #1) Run mapper:
        echo "#!/bin/csh" > $n.job
        echo "#PBS -l nodes=1:ppn=4" >> $n.job
        echo "#PBS -l walltime=14:00:00" >> $n.job
        echo "#PBS -o $n.log" >> $n.job
        echo "#PBS -e $n.err" >> $n.job
        echo "#PBS -V" >> $n.job
        echo "#PBS -M diep.hue.dinh@gmail.com" >> $n.job
        echo "#PBS -m abe" >> $n.job
        echo "#PBS -A k4zhang-group" >> $n.job
        echo "cd /state/partition1/\$USER/\$PBS_JOBID" >> $n.job
        #echo "cd $cur_dir" >> $n.job
        echo "$scripts_dir/MasterBisReadMapper.pl -i $cur_dir/$n -s $cur_dir/list_paths_Hg19 -b yes > $cur_dir/$n.status" >> $n.job
        echo "cp -r * $cur_dir/" >> $n.job
        qsub -q hotel $n.job
done
#===End===#

Mapping statistics

SAMPLE ID Total PE reads Total reads Total reads after trimming Total mapped reads %trimmed %mapped
6-P-1_map 6,304,203 12,608,406 11,953,618 10,355,738 5% 87%
6-P-2_map 6,984,763 13,969,526 13,303,090 11,570,287 5% 87%
6-P-3_map 7,758,987 15,517,974 14,491,124 12,482,525 7% 86%
6T-1_map 7,086,511 14,173,022 13,834,798 11,869,709 2% 86%
6T-2_map 7,489,616 14,979,232 14,638,550 12,820,323 2% 88%
6T-3_map 23,044,384 46,088,768 45,125,296 36,126,640 2% 80%
6T-4_map 7,345,257 14,690,514 14,302,984 12,351,984 3% 86%
6T-5_map 8,242,846 16,485,692 16,084,486 13,871,915 2% 86%
7-P-10_map 6,405,081 12,810,162 12,126,962 10,375,497 5% 86%
7-P-3_map 5,117,607 10,235,214 9,714,174 8,343,291 5% 86%
7-P-5_map 5,943,036 11,886,072 11,311,240 9,868,792 5% 87%
7-P-6_map 8,151,067 16,302,134 15,454,040 13,420,765 5% 87%
7-P-7_map 8,006,228 16,012,456 15,215,062 13,264,972 5% 87%
7-P-8_map 6,321,921 12,643,842 11,948,422 10,309,480 6% 86%
7T-1_map 7,397,882 14,795,764 14,414,610 12,579,473 3% 87%
7T-2_map 7,913,136 15,826,272 15,471,842 13,386,508 2% 87%
7T-4_map 7,428,250 14,856,500 14,495,860 12,632,367 2% 87%
7T-5_map 7,933,340 15,866,680 15,474,202 13,465,056 2% 87%
NC-7_map 8,140,557 16,281,114 15,329,258 11,685,910 6% 76%
PC-P_2_map 6,236,300 12,472,600 11,848,168 10,306,946 5% 87%
PC-P_4_map 6,400,370 12,800,740 12,191,246 10,561,291 5% 87%
PC-P_9_map 7,500,258 15,000,516 14,213,460 12,272,000 5% 86%
PCT-1_map 7,092,180 14,184,360 13,848,186 11,921,316 2% 86%
PCT-2_map 8,566,243 17,132,486 16,739,144 14,465,075 2% 86%
PCT-4_map 8,189,668 16,379,336 16,003,166 13,781,204 2% 86%
PCT-6_map 9,228,450 18,456,900 17,987,752 15,681,405 3% 87%
PCT-7_map 7,697,260 15,394,520 15,030,202 12,980,554 2% 86%

SNP matrix

  • Run MasterBisReadMapper with variant calling. Since I already have the sam files to give as input, MasterBisReadMapper will not need to re-map the data.
  • Homozygous SNPs are also called at dbSNP138 positions.
  • After getting the *filtered.SNP.txt files, generate the tped and tfam files for plink.
 /home/dinh/scripts/BisReadMapper/src/snp2tfiles.pl
  • Merge tped files into the large tped matrix for plink.
 /home/dinh/scripts/BisReadMapper/src/tped-merge.pl
  • Run plink:
 /home/nplongth/softwares/plink-1.07-x86_64/plink --noweb --tfile monod_141216 --recode --transpose --out monod_141216.plink
 /home/nplongth/softwares/plink-1.07-x86_64/plink --noweb --tfile monod_141216.plink --cluster --matrix
  • the plink.mibs fie is a N x N matrix of genome-wide average IBS pairwise identities
  • use R to plot the dendrogram:
 A = read.table("plink.mibs", F)
 labels = read.table("monod_141216.plink.tfam",F)
 colnames(A) = labels$V2
 plot(hclust(as.dist(1-A)), main="plink.mibs")
 dev.off()
  • SNPs dendrogram:
 File:Monod 141216 plink mibs.png