Matt:LabNotes/2016-3-31: Difference between revisions
Jump to navigation
Jump to search
>Mzcai (Created page with "=Bead with PKP2 Target for DARTFISH Positive Control== *Using PA gel may prevent diffusion of probes and enzymes during DARTFISH *To test this and to have a positive control f...") |
>Mzcai |
||
Line 14: | Line 14: | ||
==Capture with CA12kNov2014 V4 in tube== | ==Capture with CA12kNov2014 V4 in tube== | ||
[[Matt:LabNotes/2015-5-18 | Reference protocol]] | |||
==PCR + Sequencing Adapters== | ==PCR + Sequencing Adapters== |
Revision as of 01:35, 8 April 2016
Bead with PKP2 Target for DARTFISH Positive Control=
- Using PA gel may prevent diffusion of probes and enzymes during DARTFISH
- To test this and to have a positive control for future experiments need to design a synthetic target
- Attach target to magnetic streptavidin bead
- Design oligonucleotide with biotin 5' modification
- Chose PKP2 gene because haven't detected it in any DARTFISH samples
- Also this specific padlock probe has very high efficiency when measured in tube
PKP2_control /5BiosG/AAAAAAGAGATGGCTGTCTTTTTCACACTTGGGTCACCAACATGCAGCATCTTTC