Matt:LabNotes/2016-3-31: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
>Mzcai
Line 10: Line 10:


==Link PKP2_control oligo to Streptavidin Bead==
==Link PKP2_control oligo to Streptavidin Bead==
#Make 2X B&W (Binding and Wash) Buffer
#*16ml 5uM NaCl + 80ul 5uM EDTA + 100ul 4uM Tris-HCl + 23.82ml H2O
#Resuspend beads by vortexing
#Transfer 100ul of beads (10ug/ul) to new tube
#Pull down by magnet 2min and remove supernatant
#Wash 3x with 100ul 1X B&W Buffer by resuspending and then removing supernatant
#Resuspend in 200ul 2X B&W Buffer
#Add 200ul of 2.5uM PKP2_Control
#Incubate 15min at RT gently rotating
#Pull down with magnet
#Wash 3x with 1X B&W Buffer
#Resuspend in 1ml 1X PBS


==Measure DNA Concentration==
==Measure DNA Concentration==

Revision as of 19:30, 8 April 2016

Bead with PKP2 Target for DARTFISH Positive Control=

  • Using PA gel may prevent diffusion of probes and enzymes during DARTFISH
  • To test this and to have a positive control for future experiments need to design a synthetic target
    • Attach target to magnetic streptavidin bead
  • Design oligonucleotide with biotin 5' modification
    • Chose PKP2 gene because haven't detected it in any DARTFISH samples
    • Also this specific padlock probe has very high efficiency when measured in tube
 PKP2_control	/5BiosG/AAAAAAGAGATGGCTGTCTTTTTCACACTTGGGTCACCAACATGCAGCATCTTTC

Link PKP2_control oligo to Streptavidin Bead

  1. Make 2X B&W (Binding and Wash) Buffer
    • 16ml 5uM NaCl + 80ul 5uM EDTA + 100ul 4uM Tris-HCl + 23.82ml H2O
  2. Resuspend beads by vortexing
  3. Transfer 100ul of beads (10ug/ul) to new tube
  4. Pull down by magnet 2min and remove supernatant
  5. Wash 3x with 100ul 1X B&W Buffer by resuspending and then removing supernatant
  6. Resuspend in 200ul 2X B&W Buffer
  7. Add 200ul of 2.5uM PKP2_Control
  8. Incubate 15min at RT gently rotating
  9. Pull down with magnet
  10. Wash 3x with 1X B&W Buffer
  11. Resuspend in 1ml 1X PBS

Measure DNA Concentration

Capture with CA12kNov2014 V4 in tube

Reference protocol

PCR + Sequencing Adapters