Matt:LabNotes/2016-3-31: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
>Mzcai
Line 35: Line 35:
==Capture with CA12kNov2014 V4 in tube==
==Capture with CA12kNov2014 V4 in tube==
[[Matt:LabNotes/2015-5-18 | Reference protocol]]
[[Matt:LabNotes/2015-5-18 | Reference protocol]]
*Use CA12kNov2014_V4 Probes to Capture PKP2_Control oligos attached to streptavidin beads to test
====Sample Groups====
#PKP2_Control on beads
#Beads only (NTC)
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Sample #'''
| align="center" style="background:#f0f0f0;"|'''Sample Description'''
| align="center" style="background:#f0f0f0;"|'''Probes (ul)'''
| align="center" style="background:#f0f0f0;"|'''Target (ul)'''
| align="center" style="background:#f0f0f0;"|'''Target Conc (ng/ul)'''
| align="center" style="background:#f0f0f0;"|'''10X Ampligase Buffer'''
| align="center" style="background:#f0f0f0;"|'''H2O'''
| align="center" style="background:#f0f0f0;"|'''Total'''
|-
| 1||PKP2_Control||3.5||1||1.56||3||22.5||30
|-
| 2||NTC||3.5||1||0||3||22.5||30
|}
*Add 40ul Mineral Oil on top
'''Program'''<br>
* 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h
**In BioRad Thermalcycler program says: -0.2C per cycle every 30sec
* -> add 3ul AmpLigase enzyme mix (0.5U/ul AmpLigase in 1X AmpLigase buffer)
* -> 55 C 20h (actually 24h)-> 94C 2min -> add 2ul Exo I/III mix-> 37C 2h -> 94C 2min -> 4C hold.
====AmpLigase enzyme mix====
{| class="wikitable" style="text-align:center;{{table}} border = 1
| align="center" style="background:#f0f0f0;"|'''Components'''
| align="center" style="background:#f0f0f0;"|'''Stock conc.'''
| align="center" style="background:#f0f0f0;"|'''Unit'''
| align="center" style="background:#f0f0f0;"|'''Final conc.'''
| align="center" style="background:#f0f0f0;"|'''Unit'''
| align="center" style="background:#f0f0f0;"|'''Prepare volume 30ul'''
|-
| AmpLigase||5||U/ul||0.5||U/ul||2.00
|-
| 10x AmpLigase Buffer||10||x||1||x||2.00
|-
| H2O||||||||||16.00
|-
| Total||||||||||20.00
|}


==PCR + Sequencing Adapters==
==PCR + Sequencing Adapters==

Revision as of 20:07, 8 April 2016

Bead with PKP2 Target for DARTFISH Positive Control=

  • Using PA gel may prevent diffusion of probes and enzymes during DARTFISH
  • To test this and to have a positive control for future experiments need to design a synthetic target
    • Attach target to magnetic streptavidin bead
  • Design oligonucleotide with biotin 5' modification
    • Chose PKP2 gene because haven't detected it in any DARTFISH samples
    • Also this specific padlock probe has very high efficiency when measured in tube
 PKP2_control	/5BiosG/AAAAAAGAGATGGCTGTCTTTTTCACACTTGGGTCACCAACATGCAGCATCTTTC

Link PKP2_control oligo to Streptavidin Bead

  1. Make 2X B&W (Binding and Wash) Buffer
    • 16ml 5uM NaCl + 80ul 5uM EDTA + 100ul 4uM Tris-HCl + 23.82ml H2O
  2. Resuspend beads by vortexing
  3. Transfer 100ul of beads (10ug/ul) to new tube
  4. Pull down by magnet 2min and remove supernatant
  5. Wash 3x with 100ul 1X B&W Buffer by resuspending and then removing supernatant
  6. Resuspend in 200ul 2X B&W Buffer
  7. Add 200ul of 2.5uM PKP2_Control
  8. Incubate 15min at RT gently rotating
  9. Pull down with magnet
  10. Wash 3x with 1X B&W Buffer
  11. Resuspend in 1ml 1X PBS

Measure DNA Concentration

  • Use Qubit ssDNA kit to measure amount of ssDNA on beads
    • Assume free biotin-oligos have been all washed away
    • Measure only streptavidin bead as well for base-line
  • Beads + DNA: 1.56ng/ul
  • Beads only: 164pg/ul
  • Don't trust the quantitation but it shows ssDNA was bound to beads

Capture with CA12kNov2014 V4 in tube

Reference protocol

  • Use CA12kNov2014_V4 Probes to Capture PKP2_Control oligos attached to streptavidin beads to test

Sample Groups

  1. PKP2_Control on beads
  2. Beads only (NTC)
Sample # Sample Description Probes (ul) Target (ul) Target Conc (ng/ul) 10X Ampligase Buffer H2O Total
1 PKP2_Control 3.5 1 1.56 3 22.5 30
2 NTC 3.5 1 0 3 22.5 30
  • Add 40ul Mineral Oil on top

Program

  • 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h
    • In BioRad Thermalcycler program says: -0.2C per cycle every 30sec
  • -> add 3ul AmpLigase enzyme mix (0.5U/ul AmpLigase in 1X AmpLigase buffer)
  • -> 55 C 20h (actually 24h)-> 94C 2min -> add 2ul Exo I/III mix-> 37C 2h -> 94C 2min -> 4C hold.

AmpLigase enzyme mix

Components Stock conc. Unit Final conc. Unit Prepare volume 30ul
AmpLigase 5 U/ul 0.5 U/ul 2.00
10x AmpLigase Buffer 10 x 1 x 2.00
H2O 16.00
Total 20.00

PCR + Sequencing Adapters