Matt:LabNotes/2016-3-31: Difference between revisions
Jump to navigation
Jump to search
>Mzcai |
>Mzcai m (→TBU Gel Check) |
||
Line 161: | Line 161: | ||
===TBU Gel Check=== | ===TBU Gel Check=== | ||
*Load 2ul of each sample + 2ul loading dye | *Load 2ul of each sample + 2ul loading dye | ||
[[File:20160406_PP_capture_seq_library.jpg| | [[File:20160406_PP_capture_seq_library.jpg|150px]] | ||
*Lane 1: Low Mass Ladder | |||
*Lane 2: Erin's capture of gDNA from CA12kNov2014_V4 that had 3 extra cycles during Production PCR | |||
*Lane 3: Erin's capture of NTC from CA12kNov2014_V4 that had 3 extra cycles during Production PCR | |||
*Lane 4: PKP2_Control captured | |||
===Gel Size Selection=== | ===Gel Size Selection=== | ||
===TBU Gel Check=== | ===TBU Gel Check=== |
Revision as of 21:21, 8 April 2016
Bead with PKP2 Target for DARTFISH Positive Control=
- Using PA gel may prevent diffusion of probes and enzymes during DARTFISH
- To test this and to have a positive control for future experiments need to design a synthetic target
- Attach target to magnetic streptavidin bead (Dynabeads MyOne C1)
- Design oligonucleotide with biotin 5' modification
- Chose PKP2 gene because haven't detected it in any DARTFISH samples
- Also this specific padlock probe has very high efficiency when measured in tube
PKP2_control /5BiosG/AAAAAAGAGATGGCTGTCTTTTTCACACTTGGGTCACCAACATGCAGCATCTTTC
Link PKP2_control oligo to Streptavidin Bead
- Make 2X B&W (Binding and Wash) Buffer
- 16ml 5uM NaCl + 80ul 5uM EDTA + 100ul 4uM Tris-HCl + 23.82ml H2O
- Resuspend beads by vortexing
- Transfer 100ul of beads (10ug/ul) to new tube
- Pull down by magnet 2min and remove supernatant
- Wash 3x with 100ul 1X B&W Buffer by resuspending and then removing supernatant
- Resuspend in 200ul 2X B&W Buffer
- Add 200ul of 2.5uM PKP2_Control
- Incubate 15min at RT gently rotating
- Pull down with magnet
- Wash 3x with 1X B&W Buffer
- Resuspend in 1ml 1X PBS
Measure DNA Concentration
- Use Qubit ssDNA kit to measure amount of ssDNA on beads
- Assume free biotin-oligos have been all washed away
- Measure only streptavidin bead as well for base-line
- Beads + DNA: 1.56ng/ul
- Beads only: 164pg/ul
- Don't trust the quantitation but it shows ssDNA was bound to beads
Capture with CA12kNov2014 V4 in tube
- Use CA12kNov2014_V4 Probes to Capture PKP2_Control oligos attached to streptavidin beads to test
Sample Groups
- PKP2_Control on beads
- Beads only (NTC)
Sample # | Sample Description | Probes (ul) | Target (ul) | Target Conc (ng/ul) | 10X Ampligase Buffer | H2O | Total |
1 | PKP2_Control | 3.5 | 1 | 1.56 | 3 | 22.5 | 30 |
2 | NTC | 3.5 | 1 | 0 | 3 | 22.5 | 30 |
- Add 40ul Mineral Oil on top
Program
- 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h
- In BioRad Thermalcycler program says: -0.2C per cycle every 30sec
- -> add 3ul AmpLigase enzyme mix (0.5U/ul AmpLigase in 1X AmpLigase buffer)
- -> 55 C 20h (actually 24h)-> 94C 2min -> add 2ul Exo I/III mix-> 37C 2h -> 94C 2min -> 4C hold.
AmpLigase enzyme mix
Components | Stock conc. | Unit | Final conc. | Unit | Prepare volume 30ul |
AmpLigase | 5 | U/ul | 0.5 | U/ul | 2.00 |
10x AmpLigase Buffer | 10 | x | 1 | x | 2.00 |
H2O | 16.00 | ||||
Total | 20.00 |
PCR + Sequencing Adapters
Primers
Primer | Sequence | Index # |
ISB_CA_AF | AATGATACGGCGACCACCGAGATCTACACGCCTGCATATCGGGAAGCTGAAG | |
ISB_CA_AR.T1 | CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTGCCTTCCCGATATCCGACGG | Indx1 |
ISB_CA_AR.T2 | CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTGCCTTCCCGATATCCGACGG | Indx2 |
ISB_CA_AR.T3 | CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG | Indx3 |
Sample | Index | Forward Primer | Reverse Primer |
PKPK2_Control | 3 | ISB_CA_AF | ISB_CA_AR.T3 |
NTC | 1 | ISB_CA_AF | ISB_CA_AR.T1 |
PCR Test
Components | 1X Volume |
Captured template | 10 |
10uM Forward Primer | 0.4 |
10uM Reverse Primer | 0.4 |
2X KAPA SYBG MM | 12.5 |
H2O | 1.7 |
Total | 25 |
- Used 10ul of template instead of 1ul because expect low amount due to only target for 1 of the 3,500 padlock probes
Program 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x25
File:2016-04-04 PadlockProbe PKP2 in tube Test Sequence Adapter PCR.JPG
PCR
Components | 1X Volume |
Captured template | 12 |
10uM Forward Primer | 2 |
10uM Reverse Primer | 2 |
2X KAPA SYBG MM | 50 |
H2O | 34 |
Total | 100 |
- Split into duplicates of 50ul because Biorad cycler can't handle >50ul reaction volume
Program 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min
File:2016-04-05 PadlockProbe PKP2 in tube Sequence Adapter PCR.JPG
- Bead purification with 1.4:1 Beads to amplicon volume ratio
- Eluted with 50ul total for each sample
TBU Gel Check
- Load 2ul of each sample + 2ul loading dye
File:20160406 PP capture seq library.jpg
- Lane 1: Low Mass Ladder
- Lane 2: Erin's capture of gDNA from CA12kNov2014_V4 that had 3 extra cycles during Production PCR
- Lane 3: Erin's capture of NTC from CA12kNov2014_V4 that had 3 extra cycles during Production PCR
- Lane 4: PKP2_Control captured