Matt:LabNotes/2017-5-19: Difference between revisions
Jump to navigation
Jump to search
>Mzcai mNo edit summary |
>Mzcai mNo edit summary |
||
Line 1: | Line 1: | ||
= | =Fourth Try: in tube SplintR Test with formamide and ET SSB= | ||
*[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried]] | *[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried]] | ||
*[[Matt:LabNotes/2017-5-8|Second try had unexpected trend with increasing formamide led to increased sensitivity]] | *[[Matt:LabNotes/2017-5-8|Second try had unexpected trend with increasing formamide led to increased sensitivity]] |
Revision as of 01:01, 23 May 2017
Fourth Try: in tube SplintR Test with formamide and ET SSB
- First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried
- Second try had unexpected trend with increasing formamide led to increased sensitivity
- Third try confirmed second try
- Try with 95C 3min denature before hybridization
Test Conditions
- Standard: SplintR only
- SplintR + 5% formamide
- SplintR + 7.5% formamide
- SplintR + 10% formamide
- SplintR + 12.5% formamide
- SplintR + 15% formamide
- SplintR + 17.5% formamide
- Positive Control: Ampligase
- For each test conditions have
- one sample with ALL padlock probes and template
- Should see amplification
- one sample with all padlock probes with NO MALAT1 template
- Should not see amplification
- one sample with ALL padlock probes and template
Padlock Probes and Template
- ppCUX2
- ppBCL11B
- ppRELN_1
- ppGFAP
- ppMALAT1
- /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
- Template for ppMALAT1: MALAT1_template
- /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT
Protocol
Sample # | Condition | 30nM PP + Template | 10X Buffer | Formamide | H2O | Total |
1 | SplintR | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 22.5 or 21.6 | 30 |
2 | SplintR + 5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 1.5 | 21 or 20.1 | 30 |
3 | SplintR + 7.5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 2.25 | 20.25 or 19.35 | 30 |
4 | SplintR + 10% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 3 | 19.5 or 18.6 | 30 |
5 | SplintR + 12.5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 3.75 | 18.75 or 17.85 | 30 |
6 | SplintR + 15% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 4.5 | 18 or 17.1 | 30 |
7 | SplintR + 17.5 formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 5.25 | 17.25 or 16.35 | 30 |
8 | Ampligase | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 22.5 or 21.6 (these were added before realizing wrong volume. Kept as is) | 30 |
- Combine padlock probes and template in 1X Ligase buffer and possibly formamide
- Add mineral oil on top
- Incubate at 95C for 10min
- Incubate at 55C for 18hr
- To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
- Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
- Move samples 1-7 to 37C
- Add 3ul SplintR Mix and incubate 15min
- SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
- Incubate at 94C for 10min
- Put all samples on ice and add 2ul Exo I/III mix
- Incubate at 37C for 1hr
- Incubate at 94C for 10min
- qPCR all 16 samples with triplicates
Components | 1X Volume | 48X Volume |
Captured template | 1 | 0 |
10uM ISB_CA_AF | 0.4 | 19.2 |
10uM ISB_CA_AR.T2 | 0.4 | 19.2 |
2X KAPA SYBG MM | 12.5 | 600 |
H2O | 10.7 | 513.6 |
Total | 25 | 1,152 |
- Aliquot 24ul from 48X master mix and add 1ul captured template
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min