Matt:LabNotes/2017-6-19: Difference between revisions
Jump to navigation
Jump to search
>Mzcai |
>Mzcai mNo edit summary |
||
Line 203: | Line 203: | ||
Program | Program | ||
98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min | 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min | ||
[[Media:]] | |||
[[File:]] | |||
[[File:]] | |||
*No separation between DNA, RNA, and NTC samples for SplintR | |||
*Sequence results to see if there's no difference really | |||
**Stop Ampligase NTC at 28 cycles | |||
**Stop others at 19 cycles | |||
===Add Sequence Adapters PCR=== | ===Add Sequence Adapters PCR=== | ||
====Primers==== | ====Primers==== | ||
Line 230: | Line 238: | ||
| 2||2||ISB_CA_AF||ISB_CA_AR.T2 | | 2||2||ISB_CA_AF||ISB_CA_AR.T2 | ||
|- | |- | ||
| 3 | | 3||1||ISB_CA_AF||ISB_CA_AR.T1 | ||
|- | |- | ||
| | | 4||2||ISB_CA_AF||ISB_CA_AR.T2 | ||
|- | |- | ||
| | | 5||3||ISB_CA_AF||ISB_CA_AR.T3 | ||
|- | |- | ||
| | | 6||1||ISB_CA_AF||ISB_CA_AR.T1 | ||
|- | |- | ||
| | | 7||2||ISB_CA_AF||ISB_CA_AR.T2 | ||
|- | |- | ||
| | | 8||3||ISB_CA_AF||ISB_CA_AR.T3 | ||
|} | |} | ||
====PCR==== | ====PCR==== | ||
Line 268: | Line 255: | ||
| align="center" style="background:#f0f0f0;"|'''Components''' | | align="center" style="background:#f0f0f0;"|'''Components''' | ||
| align="center" style="background:#f0f0f0;"|'''1X Volume''' | | align="center" style="background:#f0f0f0;"|'''1X Volume''' | ||
| align="center" style="background:#f0f0f0;"|''' | | align="center" style="background:#f0f0f0;"|'''8.5X Volume''' | ||
|- | |- | ||
| Captured template|| | | Captured template||5||0 | ||
|- | |- | ||
| 10uM Forward Primer||2|| | | 10uM Forward Primer||2||17 | ||
|- | |- | ||
| 10uM Reverse Primer||2||0 | | 10uM Reverse Primer||2||0 | ||
|- | |- | ||
| 2X KAPA SYBG MM||50|| | | 2X KAPA SYBG MM||50||425 | ||
|- | |- | ||
| H2O|| | | H2O||41||348.5 | ||
|- | |- | ||
| Total||100|| | | Total||100||790.5 | ||
|} | |} | ||
*Aliquot | |||
*Aliquot 93ul from 8.5X master mix and add 5ul captured template and 2ul corresponding reverse primer | |||
Program | Program | ||
98C | 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min | ||
*Bead purification with 1.5:1 Beads to amplicon volume ratio | *Bead purification with 1.5:1 Beads to amplicon volume ratio | ||
**Eluted with 50ul total for each sample | **Eluted with 50ul total for each sample | ||
Revision as of 21:44, 26 June 2017
Agi15k_Feb2017 V4 + 5% formamide in vitro Capture
Calculate Probes Needed
V4
Probe:target | 1000:1 | ' |
Probe size | 4998 | probes |
DNA templet | 300 | ng |
gDNA MW | 1.95x10^12 | g/mol |
gDNA (300ng) | 1.5385x10^-19 | mol |
Probe (1000:1) | 1.5385x10^-16 | mol |
Probe MW (4998, 157nt) | 2.387x10^8 | g/mol |
Amount Probe req'd | 36.7 | ng |
Probes, Target and Ampligase Buffer Mix
- gDNA: 12878 (80.3ng/ul)
- UHRR: 740000-41 (1ug/ul)
- Agi15k_Feb2017 Probe Design
- V4 Probe Production (10.3 ng/ul)
Sample | Condition | V4 (10.3ng/ul) | 12878 DNA (80.3ng/ul) | UHRR (1ug/ul) | Ampligase Buffer | SplintR Buffer | Formamide or DMF | Ribolock 40U/ul | H2O | Total |
1 | Ampligase DNA | 3.6 | 3.8 | 0 | 3 | 0 | 0 | 0 | 19.6 | 30 |
2 | Ampligase NTC | 3.6 | 0 | 0 | 3 | 0 | 0 | 0 | 23.4 | 30 |
3 | SplintR 10% DMF DNA | 3.6 | 3.8 | 0 | 0 | 3 | 3 | 0 | 16.6 | 30 |
4 | SplintR 10% DMF RNA | 3.6 | 0 | 1 | 0 | 3 | 3 | 0.5 | 18.9 | 30 |
5 | SplintR 10% DMF NTC | 3.6 | 0 | 0 | 0 | 3 | 3 | 0 | 20.4 | 30 |
6 | SplintR 5% formamide DNA | 3.6 | 3.8 | 0 | 0 | 3 | 1.5 | 0 | 18.1 | 30 |
7 | SplintR 5% formamide RNA | 3.6 | 0 | 1 | 0 | 3 | 1.5 | 0.5 | 20.4 | 30 |
8 | SplintR 5% formamide NTC | 3.6 | 0 | 0 | 0 | 3 | 1.5 | 0 | 21.9 | 30 |
Program
- 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 16h
- Should have added RiboLock after reached 55C since it would be denatured at 95C
- Ampligase: add 3ul AmpLigase enzyme mix (0.5U/ul AmpLigase in 1X AmpLigase buffer)
- SplintR: add 3ul SplintR enzyme mix (10ul SplintR + 2ul 10X SplintR Buffer + 4ul Ribolock + 4ul H2O)
- Ampligase: -> 55 C 20h -> 94C 2min -> add 2ul Exo I/III mix -> 37C 1h -> 94C 2min -> 4C hold
- SplintR: -> 37 C 30min -> 94C 10min -> add 2ul Exo I/III mix -> 37C 1h -> 94C 2 min -> 4C hold
- Take 30ul and purify with Zymo columns
- Left in 4C 1 hour after first column spin down
- Elute 10ul
AmpLigase enzyme mix
Components | Stock conc. | Unit | Final conc. | Unit | Prepare volume 10ul |
AmpLigase | 5 | U/ul | 0.5 | U/ul | 1.00 |
10x AmpLigase Buffer | 10 | x | 1 | x | 1.00 |
H2O | 8.00 | ||||
Total | 10.00 |
Quantify
- qPCR all 8 samples 1ul each with triplicates
Components | 1X Volume | 25X Volume |
Captured template | 1 | 0 |
10uM ISB_CA_AF | 0.4 | 10 |
10uM ISB_CA_AR.T2 | 0.4 | 10 |
2X KAPA SYBG MM | 12.5 | 312.5 |
H2O | 10.7 | 267.5 |
Total | 25 | 600 |
- Aliquot 24ul from 24X master mix and add 1ul captured template
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min
[[Media:]] [[File:]] [[File:]]
- No separation between DNA, RNA, and NTC samples for SplintR
- Sequence results to see if there's no difference really
- Stop Ampligase NTC at 28 cycles
- Stop others at 19 cycles
Add Sequence Adapters PCR
Primers
Primer | Sequence | Index # |
ISB_CA_AF | AATGATACGGCGACCACCGAGATCTACACGCCTGCATATCGGGAAGCTGAAG | |
ISB_CA_AR.T1 | CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTGCCTTCCCGATATCCGACGG | Indx1 |
ISB_CA_AR.T2 | CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTGCCTTCCCGATATCCGACGG | Indx2 |
ISB_CA_AR.T3 | CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG | Indx3 |
Sample | Index | Forward Primer | Reverse Primer |
1 | 1 | ISB_CA_AF | ISB_CA_AR.T1 |
2 | 2 | ISB_CA_AF | ISB_CA_AR.T2 |
3 | 1 | ISB_CA_AF | ISB_CA_AR.T1 |
4 | 2 | ISB_CA_AF | ISB_CA_AR.T2 |
5 | 3 | ISB_CA_AF | ISB_CA_AR.T3 |
6 | 1 | ISB_CA_AF | ISB_CA_AR.T1 |
7 | 2 | ISB_CA_AF | ISB_CA_AR.T2 |
8 | 3 | ISB_CA_AF | ISB_CA_AR.T3 |
PCR
Components | 1X Volume | 8.5X Volume |
Captured template | 5 | 0 |
10uM Forward Primer | 2 | 17 |
10uM Reverse Primer | 2 | 0 |
2X KAPA SYBG MM | 50 | 425 |
H2O | 41 | 348.5 |
Total | 100 | 790.5 |
- Aliquot 93ul from 8.5X master mix and add 5ul captured template and 2ul corresponding reverse primer
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x30 -> 72C 3min
- Bead purification with 1.5:1 Beads to amplicon volume ratio
- Eluted with 50ul total for each sample