Jie:LabNotes/CpgSeq/2009-8-5: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Jie deng
No edit summary
>Jie deng
No edit summary
Line 67: Line 67:
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.


  [[Image:20090812_PhiX_quantification.png]]
  [[Image:20090812_PhiX_quantification.png|300px]]

Revision as of 17:14, 13 August 2009

shotgun library construction of Parkinson's samples

The captured DNA of samples were sent to Covaris for shearing.refer to LabNotes on [1] see 1.5.2

endrepair with enzymatic end-repair kit

                                       x10
100 ul DNA 
 13 ul 10X End-Repair Buffer           130
 13 ul dNTP Mix                        130
  4 ul End-Repair Enzyme Mix            40
130 ul Total reaction volume
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.

A tail addition

                                   x11
  Blunt-ended DNA        10ul      10 each
  10X Klenow buffer      1.6ul     17.6
  1mM dATP                3ul      33
  Klenow fragment (exo-)  1ul      11
  37C 30min, purified with MinElute columns, eluted with 12ul EB. 

adaptor ligation

                                               x12
    DNA                                10ul
    2x QuickLigase buffer (enzymatic)  15ul     180
    20uM Adaptor oligo mix              3ul      36
    T4 DNA QuickLigase (enzymatic)      2ul      24
    Incubate at RT for 15 minutes.
    Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.

PCR

   Template                5ul        
   2x iProof mix          50ul       
   Solexa_PCR_up (10uM)    4ul        
   Solexa_PCR_lo_PE (10uM) 4ul        
   H2O                     37ul       
   50X SYBG I             0.2ul
98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> 
72C 3min -> 15C hold.

File:20090807 shotgun lib Parkinson samples.jpg20090807_shotgun_lib_Parkinson_samples

quantification of shotgun library

File:20090810 shotgun lib quanti Parkinson No1 9 Phix.jpg20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix

gel quantification results:
Par_1: 6.14ng/ul x 40ul;
Par_9: 7.54ng/ul x 40ul;
PhiX lib: 7.43ng/ul (size 275-325bp)
Nanodrop results:
Par_1: 24.9ng/ul x 40ul;
Par_9: 21.8ng/ul x 40ul;
PhiX lib: 5.9ng/ul

quantification with qPCR

I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM.
I dilute the Parkinson's lib with 1:10 ratio. 
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
                                    x 14
  Template                 1ul          
  2x iProof mix           25ul        350
  syb_RP7 (100uM)        0.2ul        
  Syb_FP5 (100uM)        0.2ul        
  H2O                     24ul       
  50X SYBG I             0.2ul

98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.

File:20090812 PhiX quantification.png