Jie:LabNotes/CpgSeq/2009-8-7: Difference between revisions
>Sam Chiang No edit summary |
>Sam Chiang No edit summary |
||
Line 69: | Line 69: | ||
add 3ul USER to 30ul of each samples. 37C for 1h. | add 3ul USER to 30ul of each samples. 37C for 1h. | ||
10 x S1 nuclease buffer: 4 ul | 10 x S1 nuclease buffer: 4 ul | ||
DNA after USER digestion: 33ul | DNA after USER digestion: 33ul | ||
S1 nuclease (10U/ul): 1ul | S1 nuclease (10U/ul): 1ul | ||
ddH2O 2ul | ddH2O 2ul | ||
37C 10mins. | 37C 10mins. | ||
Minelute cloumn purify. Elute in | Minelute cloumn purify. Elute in 18ul H2O. | ||
===endrepair with enzymatic end-repair kit=== | |||
x3 | |||
17 ul DNA | |||
2.5 ul 10X End-Repair Buffer 7.5 | |||
2.5 ul dNTP Mix 7.5 | |||
3 ul End-Repair Enzyme Mix 9 | |||
25 ul Total reaction volume | |||
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O. | |||
=== A tail addition=== | |||
x3 | |||
Blunt-ended DNA 10ul 10 each | |||
10X Klenow buffer 1.6ul 4.8 | |||
1mM dATP 3ul 9 | |||
Klenow fragment (exo-) 1ul 3 | |||
37C 30min, purified with MinElute columns, eluted with 12ul EB. | |||
===adaptor ligation=== | |||
x4 | |||
DNA 10ul | |||
2x QuickLigase buffer (enzymatic) 15ul 60 | |||
20uM Adaptor oligo mix 3ul 12 | |||
T4 DNA QuickLigase (enzymatic) 2ul 8 | |||
Incubate at RT for 15 minutes. | |||
Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O. | |||
===PCR=== | |||
Template 5ul | |||
2x iProof mix 50ul | |||
Solexa_PCR_up (10uM) 4ul | |||
Solexa_PCR_lo_PE (10uM) 4ul | |||
H2O 37ul | |||
50X SYBG I 0.2ul | |||
98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> | |||
72C 3min -> 15C hold. | |||
20090807_shotgun_lib_Parkinson_samples | |||
[edit] quantification of shotgun library | |||
20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix | |||
gel quantification results: | |||
Par_1: 6.14ng/ul x 40ul; | |||
Par_9: 7.54ng/ul x 40ul; | |||
PhiX lib: 7.43ng/ul (size 275-325bp) | |||
Nanodrop results: | |||
Par_1: 24.9ng/ul x 40ul; | |||
Par_9: 21.8ng/ul x 40ul; | |||
PhiX lib: 5.9ng/ul | |||
[edit] quantification with qPCR | |||
I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM. | |||
I dilute the Parkinson's lib with 1:10 ratio. | |||
Syb_FP5: ATGATACGGCGACCACCGAG | |||
Syb_RP7: CAAGCAGAAGACGGCATACGAG | |||
x 14 | |||
Template 1ul | |||
2x iProof mix 25ul 350 | |||
syb_RP7 (100uM) 0.2ul | |||
Syb_FP5 (100uM) 0.2ul | |||
H2O 24ul | |||
50X SYBG I 0.2ul | |||
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold. | |||
Retrieved from "http://genome-tech.ucsd.edu/LabNotes/index.php/Jie:LabNotes/CpgSeq/2009-8-5" | |||
Views | |||
* Jie | |||
* Discussion | |||
* Edit | |||
* History | |||
* Move | |||
* Watch | |||
Personal tools | |||
* Sam Chiang | |||
* My talk | |||
* My preferences | |||
* My watchlist | |||
* My contributions | |||
* Log out | |||
Navigation | |||
* Main Page | |||
* Current events | |||
* Recent changes | |||
* Random page | |||
Investigators | |||
* Kun Zhang | |||
* Alice Li | |||
* Jie Deng | |||
* Athurva Gore | |||
* Jeff Gole | |||
* Alan Fung | |||
* Sam Chiang | |||
Search | |||
Toolbox | |||
* What links here | |||
* Related changes | |||
* Upload file | |||
* Special pages | |||
* Printable version | |||
* Permanent link |
Revision as of 20:45, 16 August 2009
breast cancer patient peripheral blood DNA sample capture by cpg97k
gDNA extraction from blood
I used the Qiagen FlexiGene DNA kit to exact the DNA from blood. yield: 05192A18: 83.5ng/ul x 100ul; 05192B09: 72.7ng/ul x 100ul
Bisulfite conversion of patient DNA
No | sample | sample concentration | sample volumn | ddH2O | conversion reagents | conversed DNA concentration and volumn |
05192A18 | 83.5ng/ul x 1 tube | 20ul | 0ul | 130ul | 148.2ng/ul x 10ul | |
05192B09 | 72.7ng/ulx 1 tubes | 20ul | 0ul | 130ul | 127.8ng/ul x 10ul |
cpature by cpg97k
No | sample | sample concentration | 10xLigase buffer | template+cpg97k_A(60ng/ul_08/10) vol+suppress oligo+H2O | template+cpg97k_B(60ng/ul_08/10) vol+suppressor oligo+H2O |
05192A18 | 148.2ng/ul | 1ul | 3+1.5ul+1ul+3.5ul | 3+1.5ul+1ul+3.5ul | |
05192B09 | 127.8ng/ul | 1ul | 3+1.5ul+1ul+3.5ul | 3+1.5ul+1ul+3.5ul |
PCR
Template 15ul x4 2X iProof Mastermix 50ul AmpF6.3SoL (10uM) 4ul AmpR6.3SoL (10uM) 4ul 50X SYBG I 0.4ul H2O 26.6ul
98C 30S -> (98C 10S -> 58C 20S -> 72C 20S) x 8 ->(98C 10S -> 72C 20S) x 8 ->72C 3 min -> 15C hold. Qiaquick purification and e-gel size selection.
PCR amplification with AmpF6.3NH2/AmpR6.3NH2 and dUTP:dNTP 1:40
I did the dUTP_PCR with template from the Qiaquick purified captured targets of 97k. For each targets, I did 200ul PCR reaction. reaction system x8 H2O 42.6ul 340.8ul 2x Master mix 50ul 400ul dUTP(1mM) 2ul 16ul AmpF6.3NH2(10uM) 2ul 16ul AmpR6.3NH2(10uM) 2ul 16ul 50x SYBG I 0.4ul 3.2ul template 0.25ul/each for e-gel purified cpg97k Total 100ul 1400ul
Purify with qiaquick column. Quantify with nanodrop and mix them with 1:1 ratio.
USER and S1 digestion
add 3ul USER to 30ul of each samples. 37C for 1h. 10 x S1 nuclease buffer: 4 ul DNA after USER digestion: 33ul S1 nuclease (10U/ul): 1ul ddH2O 2ul
37C 10mins. Minelute cloumn purify. Elute in 18ul H2O.
endrepair with enzymatic end-repair kit
x3 17 ul DNA 2.5 ul 10X End-Repair Buffer 7.5 2.5 ul dNTP Mix 7.5 3 ul End-Repair Enzyme Mix 9 25 ul Total reaction volume
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.
A tail addition
x3 Blunt-ended DNA 10ul 10 each 10X Klenow buffer 1.6ul 4.8 1mM dATP 3ul 9 Klenow fragment (exo-) 1ul 3 37C 30min, purified with MinElute columns, eluted with 12ul EB.
adaptor ligation
x4 DNA 10ul 2x QuickLigase buffer (enzymatic) 15ul 60 20uM Adaptor oligo mix 3ul 12 T4 DNA QuickLigase (enzymatic) 2ul 8 Incubate at RT for 15 minutes. Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.
PCR
Template 5ul 2x iProof mix 50ul Solexa_PCR_up (10uM) 4ul Solexa_PCR_lo_PE (10uM) 4ul H2O 37ul 50X SYBG I 0.2ul
98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> 72C 3min -> 15C hold.
20090807_shotgun_lib_Parkinson_samples [edit] quantification of shotgun library
20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix
gel quantification results: Par_1: 6.14ng/ul x 40ul; Par_9: 7.54ng/ul x 40ul; PhiX lib: 7.43ng/ul (size 275-325bp)
Nanodrop results: Par_1: 24.9ng/ul x 40ul; Par_9: 21.8ng/ul x 40ul; PhiX lib: 5.9ng/ul
[edit] quantification with qPCR
I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM. I dilute the Parkinson's lib with 1:10 ratio. Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG
x 14 Template 1ul 2x iProof mix 25ul 350 syb_RP7 (100uM) 0.2ul Syb_FP5 (100uM) 0.2ul H2O 24ul 50X SYBG I 0.2ul
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
Retrieved from "http://genome-tech.ucsd.edu/LabNotes/index.php/Jie:LabNotes/CpgSeq/2009-8-5"
Views
* Jie * Discussion * Edit * History * Move * Watch
Personal tools
* Sam Chiang * My talk * My preferences * My watchlist * My contributions * Log out
Navigation
* Main Page * Current events * Recent changes * Random page
Investigators
* Kun Zhang * Alice Li * Jie Deng * Athurva Gore * Jeff Gole * Alan Fung * Sam Chiang
Search
Toolbox
* What links here * Related changes * Upload file * Special pages * Printable version * Permanent link