Jie:LabNotes/CpgSeq/2009-8-7: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Sam Chiang
No edit summary
>Sam Chiang
No edit summary
Line 69: Line 69:


  add 3ul USER to 30ul of each samples. 37C for 1h.
  add 3ul USER to 30ul of each samples. 37C for 1h.
                                           x4
                                            
  10 x S1 nuclease buffer:  4 ul           16ul
  10 x S1 nuclease buffer:  4 ul          
  DNA after USER digestion: 33ul            33ul each
  DNA after USER digestion: 33ul             
  S1 nuclease (10U/ul):      1ul            4ul
  S1 nuclease (10U/ul):      1ul             
  ddH2O                      2ul           8ul
  ddH2O                      2ul          


  37C 10mins.
  37C 10mins.
  Minelute cloumn purify. Elute in 16ul H2O.
  Minelute cloumn purify. Elute in 18ul H2O.
 
===endrepair with enzymatic end-repair kit===
 
                                        x3
17 ul DNA
2.5 ul 10X End-Repair Buffer          7.5
2.5 ul dNTP Mix                        7.5
  3  ul End-Repair Enzyme Mix            9
25  ul Total reaction volume
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.
 
=== A tail addition===
 
                                  x3
  Blunt-ended DNA        10ul      10 each
  10X Klenow buffer      1.6ul    4.8
  1mM dATP                3ul      9
  Klenow fragment (exo-)  1ul      3
  37C 30min, purified with MinElute columns, eluted with 12ul EB.
 
===adaptor ligation===
 
                                              x4
    DNA                                10ul
    2x QuickLigase buffer (enzymatic)  15ul    60
    20uM Adaptor oligo mix              3ul    12
    T4 DNA QuickLigase (enzymatic)      2ul    8
    Incubate at RT for 15 minutes.
    Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.
 
===PCR===
 
  Template                5ul       
  2x iProof mix          50ul     
  Solexa_PCR_up (10uM)    4ul       
  Solexa_PCR_lo_PE (10uM) 4ul       
  H2O                    37ul     
  50X SYBG I            0.2ul
98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)->
72C 3min -> 15C hold.
 
20090807_shotgun_lib_Parkinson_samples
[edit] quantification of shotgun library
 
20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix
 
gel quantification results:
Par_1: 6.14ng/ul x 40ul;
Par_9: 7.54ng/ul x 40ul;
PhiX lib: 7.43ng/ul (size 275-325bp)
 
Nanodrop results:
Par_1: 24.9ng/ul x 40ul;
Par_9: 21.8ng/ul x 40ul;
PhiX lib: 5.9ng/ul
 
[edit] quantification with qPCR
 
I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM.
I dilute the Parkinson's lib with 1:10 ratio.
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
                                    x 14
  Template                1ul         
  2x iProof mix          25ul        350
  syb_RP7 (100uM)        0.2ul       
  Syb_FP5 (100uM)        0.2ul       
  H2O                    24ul     
  50X SYBG I            0.2ul
 
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
 
 
Retrieved from "http://genome-tech.ucsd.edu/LabNotes/index.php/Jie:LabNotes/CpgSeq/2009-8-5"
Views
 
    * Jie
    * Discussion
    * Edit
    * History
    * Move
    * Watch
 
Personal tools
 
    * Sam Chiang
    * My talk
    * My preferences
    * My watchlist
    * My contributions
    * Log out
 
Navigation
 
    * Main Page
    * Current events
    * Recent changes
    * Random page
 
Investigators
 
    * Kun Zhang
    * Alice Li
    * Jie Deng
    * Athurva Gore
    * Jeff Gole
    * Alan Fung
    * Sam Chiang
 
Search
Toolbox
 
    * What links here
    * Related changes
    * Upload file
    * Special pages
    * Printable version
    * Permanent link

Revision as of 20:45, 16 August 2009

breast cancer patient peripheral blood DNA sample capture by cpg97k

gDNA extraction from blood

I used the Qiagen FlexiGene DNA kit to exact the DNA from blood. yield:
05192A18: 83.5ng/ul x 100ul;
05192B09: 72.7ng/ul x 100ul

Bisulfite conversion of patient DNA

No sample sample concentration sample volumn ddH2O conversion reagents conversed DNA concentration and volumn
05192A18 83.5ng/ul x 1 tube 20ul 0ul 130ul 148.2ng/ul x 10ul
05192B09 72.7ng/ulx 1 tubes 20ul 0ul 130ul 127.8ng/ul x 10ul


cpature by cpg97k

No sample sample concentration 10xLigase buffer template+cpg97k_A(60ng/ul_08/10) vol+suppress oligo+H2O template+cpg97k_B(60ng/ul_08/10) vol+suppressor oligo+H2O
05192A18 148.2ng/ul 1ul 3+1.5ul+1ul+3.5ul 3+1.5ul+1ul+3.5ul
05192B09 127.8ng/ul 1ul 3+1.5ul+1ul+3.5ul 3+1.5ul+1ul+3.5ul
PCR
Template                15ul        x4
2X iProof Mastermix     50ul     
AmpF6.3SoL (10uM)        4ul       
AmpR6.3SoL (10uM)        4ul          
50X SYBG I             0.4ul      
H2O                   26.6ul    
98C 30S -> (98C 10S -> 58C 20S -> 72C 20S) x 8 ->(98C 10S -> 72C 20S) x 8 ->72C 3 min -> 15C hold. 
Qiaquick purification and e-gel size selection. 

PCR amplification with AmpF6.3NH2/AmpR6.3NH2 and dUTP:dNTP 1:40

I did the dUTP_PCR with template from the Qiaquick purified captured targets of 97k. For each targets, I did 200ul PCR reaction.
reaction system                                                 x8     
H2O                                                42.6ul     340.8ul    
2x Master mix                                        50ul      400ul      
dUTP(1mM)                                             2ul       16ul       
AmpF6.3NH2(10uM)                                      2ul       16ul       
AmpR6.3NH2(10uM)                                      2ul       16ul     
50x SYBG I                                          0.4ul      3.2ul    
template                                          0.25ul/each for e-gel purified cpg97k
Total                                               100ul      1400ul
Purify with qiaquick column. Quantify with nanodrop and mix them with 1:1 ratio.

USER and S1 digestion

add 3ul USER to 30ul of each samples. 37C for 1h.
                                         
10 x S1 nuclease buffer:  4 ul           
DNA after USER digestion: 33ul            
S1 nuclease (10U/ul):      1ul            
ddH2O                      2ul           
37C 10mins.
Minelute cloumn purify. Elute in 18ul H2O.

endrepair with enzymatic end-repair kit

                                       x3
17 ul DNA 
2.5 ul 10X End-Repair Buffer           7.5
2.5 ul dNTP Mix                        7.5
 3  ul End-Repair Enzyme Mix            9
25  ul Total reaction volume

Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.

A tail addition

                                  x3
 Blunt-ended DNA        10ul      10 each
 10X Klenow buffer      1.6ul     4.8
 1mM dATP                3ul      9
 Klenow fragment (exo-)  1ul      3
 37C 30min, purified with MinElute columns, eluted with 12ul EB. 

adaptor ligation

                                              x4
   DNA                                10ul
   2x QuickLigase buffer (enzymatic)  15ul     60
   20uM Adaptor oligo mix              3ul     12
   T4 DNA QuickLigase (enzymatic)      2ul     8
   Incubate at RT for 15 minutes.
   Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.

PCR

  Template                5ul        
  2x iProof mix          50ul       
  Solexa_PCR_up (10uM)    4ul        
  Solexa_PCR_lo_PE (10uM) 4ul        
  H2O                     37ul       
  50X SYBG I             0.2ul

98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> 72C 3min -> 15C hold.

20090807_shotgun_lib_Parkinson_samples [edit] quantification of shotgun library

20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix

gel quantification results: Par_1: 6.14ng/ul x 40ul; Par_9: 7.54ng/ul x 40ul; PhiX lib: 7.43ng/ul (size 275-325bp)

Nanodrop results: Par_1: 24.9ng/ul x 40ul; Par_9: 21.8ng/ul x 40ul; PhiX lib: 5.9ng/ul

[edit] quantification with qPCR

I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM. I dilute the Parkinson's lib with 1:10 ratio. Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG

                                   x 14
 Template                 1ul          
 2x iProof mix           25ul        350
 syb_RP7 (100uM)        0.2ul        
 Syb_FP5 (100uM)        0.2ul        
 H2O                     24ul       
 50X SYBG I             0.2ul

98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.


Retrieved from "http://genome-tech.ucsd.edu/LabNotes/index.php/Jie:LabNotes/CpgSeq/2009-8-5" Views

   * Jie
   * Discussion
   * Edit
   * History
   * Move
   * Watch

Personal tools

   * Sam Chiang
   * My talk
   * My preferences
   * My watchlist
   * My contributions
   * Log out

Navigation

   * Main Page
   * Current events
   * Recent changes
   * Random page

Investigators

   * Kun Zhang
   * Alice Li
   * Jie Deng
   * Athurva Gore
   * Jeff Gole
   * Alan Fung
   * Sam Chiang

Search

Toolbox

   * What links here
   * Related changes
   * Upload file
   * Special pages
   * Printable version
   * Permanent link