AlanFung:LabNotes/DNA/2009-8-18: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Alan6017518
>Alan6017518
Line 25: Line 25:
   1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
   1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
   37C 2h.  
   37C 2h.  
*Qiaquick column purification. Elute in 12ul EB.
*Qiaquick column purification. Elute in 30ul EB.


===quantification with qPCR===
===quantification with qPCR===
Line 67: Line 67:
|  
|  
|}
|}
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
98C 30sec -> 30 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
*stopped when curve reached plateau

Revision as of 16:29, 20 August 2009

Digestion with MmeI

PGP4 PGP6 PGP10 A B
Sample 20 20 20 10 10
10X NEBuffer 4 4 4 4 3 3
1mM SAM (fresh) 8 8 8 6 6
2U/ul MmeI 1 1 1 1 1
ddH20 7 7 7 10 10
Total 40 40 40 30 30
 1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
 37C 2h. 
  • Qiaquick column purification. Elute in 30ul EB.

quantification with qPCR

  • Dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM
  • Dilute the samples to 1:10 and 1:50 ratio
  • 1:10-Add 1ul of sample to 9ul H20
  • 1:50-Add 1ul of 1:10 sample to 4ul H20
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
1nM PhiX 1:10 PGP4 1:10 PGP10 1:10 50192B
1nM PhiX 1:10 PGP4 1:10 PGP10 1:10 50192B
0.1nM PhiX 1:50 PGP4 1:50 PGP10 1:50 50192B
0.1nM PhiX 1:50 PGP4 1:50 PGP10 1:50 50192B
0.025nM PhiX 1:10 PGP6 1:10 50192A
0.025nM PhiX 1:10 PGP6 1:10 50192A
0.005nM PhiX 1:50 PGP6 1:50 50192A
0.005nM PhiX 1:50 PGP6 1:50 50192A
X29
Template 1ul
2X iProof Mix 25 725
SYB_RP7 (100uM) 0.2 5.8
SYB_FP5 (100uM) 0.2 5.8
H2O 24
50X SYBR I 0.2 5.8

98C 30sec -> 30 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.

  • stopped when curve reached plateau