AlanFung:Protocol/Construction of Solexa sequencing Library: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Alan6017518
>Alan6017518
Line 128: Line 128:


                                                                                                                
                                                                                                                
 
* TBE Gel verification (10well)
* 15ul h2o+4.5ul 6x loading dye+0.5ul 25bp ladder
* 15ul h2o+3ul 6X loading dye+2ul sample
Mix the amplicons with two sets of primers, purified with Qiaquick columns. Typically, the PCR products are clean enough for sequencing without further size selection.
Mix the amplicons with two sets of primers, purified with Qiaquick columns. Typically, the PCR products are clean enough for sequencing without further size selection.

Revision as of 21:23, 12 November 2009

Construction of Solexa sequencing library from padlock captured PCR products using NEBNext DNA Sample Prep Master Mix Set 1 Kit (E6040S/L)

  • Info Read the FAQ!!!
  • Protocol
  • The NEBNext DNA SPMMS 1 (I) is compatible with protocols requiring a 3´ A overhang on the library molecules to facilitate ligation to adapters containing a 5´ T overhang, such as Illumina’s Genomic DNA Sample Prep protocol for the Genome Analyzer II.
  • For 60bp run, we can use the library size of >180bp
  • For 80bp runs, the lower limit for the sequencing libraries should be 200bp.
  • If the library size is too small, some of the 80bp reads will reach to the other end of the adaptor sequences. we don't want to waste the sequencing $$ on the regions we don't want
  • The total size of the adaptors is 105bp, and there is another ~25bp of the capturing arm
  • The upper limit should be ~50bp above the lower limit

Overview

  • Fragmentation and end-polishing
  • Size Selection
  • Ligation
  • PCR of sequencing Library
  • QPCR quantification


Fragmentation and end-polishing (Make blunt ends with 5'P)

  • The PCR amplicons (200ng-1ug) are fragmented with Covaris sonicator to ~100bp
  • End-Repair Reactions
Fragmented DNA 85ul
10X End Repair Bufer 10ul
End Repair Enzyme Mix 5ul
  • Incubate tubes at RT for 30minutes.
  • Perform a Qiaquick purification and elute with 39ul EB buffer.
  • NOTE: For blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the chance of getting chimeric reads.
  • A-Tailing Reactions
Blunet-end DNA 37ul
10X dA-Tailing Reaction Buffer 5ul
Klenow Fragment (3'-5' exo-) 3ul
H2O 5ul

Incubated at 37C for 30min, purified with Qiaquick columns, eluted with 40 ul EB.

  • Measure concentration with nanodrop

Size selection using Invitrogen 2% SizeSelect gel

  • Fill any unused well with 30ul EB Buffer
  • Mix 15ul EB buffer with 0.5ul ladder in a 0.2ml tube
  • Load 20u end-polished DNA sample into two lanes(use 3 or more lanes if the starting DNA is more than 1ug)
  • Run the SizeSelect program for 12~14 min. Pause when the 125bp band just move into the middle collection well
  • Use pipette to extract all solution in each of the sample well, and quickly refill the wells with 20ul EB.
  • Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube)
  • Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes.
  • Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour).

Ligation. Blunt-end and TA ligations use the same protocol but slightly different adaptor sequences.

  • Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time.
ul
End-repaired & size selected DNA 36
40uM adaptor2 2
5X Quick Ligase Buffer 10
Quick Ligase 2
  • Incubate at room temperature for 15 minutes, purified with MinElute columns, eluted with 22ul EB.

PCR of sequencing library

Solexa_PCR_up: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

AmpR6.3Sol: CAAGCAGAAGACGGCATACGAGCTCTTCGGAACGATGAGCCTCCAAC

AmpF6.3rSol: CAAGCAGAAGACGGCATACGAGCTCTTCCAGATGTTATCGAGGTCCGA

Ligation products 10 10
10uM solexa PCR up 2 2
10uM AmpR6.3Sol 2 -
10uM AmpF6.3Sol - 2
2X iProof master mix (Bio-Rad) 50 50
50X SYBR Green I 0.4 0.4
H2O 36 36
  • Setup 2 master mix
F R
Ligation products
10uM solexa PCR up 13.2 13.2
10uM AmpR6.3Sol 13.2 -
10uM AmpF6.3Sol - 13.2
2X iProof master mix (Bio-Rad) 330 330
50X SYBR Green I 2.64 2.64
H2O 237.6 237.6

PCR program: 98 °C 30sec -> 8 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold.


  • TBE Gel verification (10well)
  • 15ul h2o+4.5ul 6x loading dye+0.5ul 25bp ladder
  • 15ul h2o+3ul 6X loading dye+2ul sample

Mix the amplicons with two sets of primers, purified with Qiaquick columns. Typically, the PCR products are clean enough for sequencing without further size selection.