Dinh:Protocols/Capturing Nov13: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Alan6017518
>Alan6017518
Line 43: Line 43:
  8. Add another 200ul M-Wash Buffer. Centrifuge at 15K rpm for 30 s. Discard flow through.
  8. Add another 200ul M-Wash Buffer. Centrifuge at 15K rpm for 30 s. Discard flow through.
  9. Place the column into 1.5ml microcentrifuge tube. Add 12ul M-Elution Buffer into center of column matrix. Wait 1 min. Centrifuge at 15K rpm for 30 s.  
  9. Place the column into 1.5ml microcentrifuge tube. Add 12ul M-Elution Buffer into center of column matrix. Wait 1 min. Centrifuge at 15K rpm for 30 s.  
  10. Measure the DNA with Nanodrop.
  10. Measure the DNA with Nanodrop (use M-Elution Buffer to blank)


{| border = "1"
{| border = "1"
Line 58: Line 58:
| 2
| 2
| 1019.5ng
| 1019.5ng
| 1421.7ng
| 79x10.5 = 829.5ng
| 81%
| -
| -
| 3
| 3
| 203.9ng
| 203.9ng
| 192ng
| 192ng
|
| 94%
|}


=B. November 23, 2009 - PCR Amplification of Converted DNA=
=B. November 23, 2009 - PCR Amplification of Converted DNA=

Revision as of 20:14, 25 November 2009

A. November 13, 2009 Bisulfite conversion of DNA using Zymo EZ DNA Methylation-Gold Kit

Reaction Mix (1x, 150ul):

Reagent Final Conc. #1 (3x) #2 #3
ddH20 10ul 15ul 19ul
Jurkat gDNA (203.9ng/ul) varies per tube 10ul 5ul 1ul
Conversion Reagent (prepared 11/6) 130ul 130ul 130ul

Reaction Program:

 98C -> 10 min
 64C -> 2.5 hours
 4C -> overnight

Column Purification *Washing was done twice:

1. Place a Zymo-Spin IC Column into a provided Collection tube.
2. Add 600 ul of M-Binding Buffer to spin column
3. Load the reaction mix into the spin column.
4. Close cap and mix by inverting 10 times. Centrifuge at 15K rpm for 30 s. Discard flow through.
5. Add 100ul of M-Wash Buffer. Centrifuge at 15K rpm for 30 s. Discard flow through.
6. Add 200ul M-Desulphonation Buffer and wait for 20 min. Centrifuge at 15K rpm for 30 s. Discard flow through.
7. Add 200ul M-Wash Buffer. Centrifuge at 15K rpm for 30 s. Discard flow through.
8. Add another 200ul M-Wash Buffer. Centrifuge at 15K rpm for 30 s. Discard flow through.
9. Place the column into 1.5ml microcentrifuge tube. Add 12ul M-Elution Buffer into center of column matrix. Wait 1 min. Centrifuge at 15K rpm for 30 s. 
10. Measure the DNA with Nanodrop (use M-Elution Buffer to blank)
Sample # Input Jurkat gDNA (ng) Output converted gDNA (ng) % yield
1 2039ng 198.8ng/ulx10ul = 1988ng 97%
2 1019.5ng 79x10.5 = 829.5ng 81% - 3 203.9ng 192ng 94%

B. November 23, 2009 - PCR Amplification of Converted DNA

  • Primers - From IDT
  --------------------------------------------------
  0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG
  0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA
  0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT
  0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA
  0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT
  0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA
  --------------------------------------------------

Reaction mix:

Reagent Final Conc. Vol (1x)
ddH20 7.5ul
NEB Tag 2x Master Mix 1x 20ul
Forward Primer (Chr8/21/22) (3.3uM) ~0.5uM 6ul
Reverse Primer (Chr8/21/22) (3.3uM) ~0.5uM 6ul
A/B/C/D 0.5ul
Total 40ul
A. Jurkat gDNA - 203.9 ng/ul
B. converted gDNA by Alan (200ng/ul)
C. 11-13 converted gDNA (400ng/ul)
D. 11-13 converted gDNA (135ng/ul)

Program:

      Step1   96C, 3m
      Step2   95C, 30s
      Step3   62C, 1m
      Step4   72C, 1m
      Step5   Go to step2 repeat 39 times
      Step6   72C, 5m
      Step7   4C,  Forever
      Step8   END

C. Capturing Protocol CpG30K

Positive control: Jurkat converted DNA Negative control: 1ul RNAse free ddH20