Kun:LabNotes/ExonomeSeq/2009-11-15: Difference between revisions
Jump to navigation
Jump to search
Line 16: | Line 16: | ||
** 5 candidates of SNCs found in DF6-9-9:[[media:DF6_Foreskin_HL022_snc.xlsx|DF6_Foreskin_HL022]]; | ** 5 candidates of SNCs found in DF6-9-9:[[media:DF6_Foreskin_HL022_snc.xlsx|DF6_Foreskin_HL022]]; | ||
** Nine pairs of PCR primers were designed for these variants. However, ZNF708-K259R will be excluded in the first validation experiment because the flanking sequence has many highly similar homologs on the same chromosome. | ** Nine pairs of PCR primers were designed for these variants. However, ZNF708-K259R will be excluded in the first validation experiment because the flanking sequence has many highly similar homologs on the same chromosome. | ||
{| {{table}} | |||
| align="center" style="background:#f0f0f0;"|'''PrimerID''' | |||
| align="center" style="background:#f0f0f0;"|'''LP''' | |||
| align="center" style="background:#f0f0f0;"|'''PrimerID''' | |||
| align="center" style="background:#f0f0f0;"|'''RP''' | |||
| align="center" style="background:#f0f0f0;"|'''Amplicon''' | |||
|- | |||
| TRIM25-N534K-LP||GTGGCACCAGCAGAAAATAC||TRIM25-N534K-RP||TCCCCAGAGGTTCACATACT||>chr17:52324085+52324480 396bp | |||
|- | |||
| SDR16C5-D139Y-LP||GTGAGCCACCTGGAGTATTT||SDR16C5-D139Y-RP||AAAGAAGTCGGCGATGTTTC||>chr8:57386991+57387395 405bp | |||
|- | |||
| NTRK3-L585R-LP||ACAATGCCTAGAGCTTCCAA||NTRK3-L585R-RP||CTGCAGCAAAATGGAGTGTT||>chr15:86323500+86323903 404bp | |||
|- | |||
| DAPL1-P18P-LP||GTCTCCTGCAGACATCTACC||DAPL1-P18P-RP||CAGAGAAGCTTCCGTCTGTC||>chr2:159359887+159360285 399bp | |||
|- | |||
| ZZZ3-K214R-LP||CTTACCCTCCACTTTTGCAC||ZZZ3-K214R-RP||ACGACTCAGGTATTGTATGTC||>chr1:77816893+77817200 308bp | |||
|- | |||
| PPP1R2-P97R-LP||CAGTATCCCAAGTGCAGGTA||PPP1R2-P97R-RP||CCCTTGTTTTTGTGGCTGAA||>chr3:196732652+196733047 396bp | |||
|- | |||
| ITCH-T556A-LP||ACCCATGGAAGCAAGAAGAA||ITCH-T556A-RP||CAAAAGCGGGTCCTAAGCTA||>chr20:32522599+32523040 442bp | |||
|- | |||
| NEK5-G23E-LP||TGGTTGCTGTTTGGACAATG||NEK5-G23E-RP||GCTGGGAGGAAAGTTTTAGC||>chr13:51599342+51599754 413bp | |||
|} |
Latest revision as of 21:50, 15 November 2009
Analysis of iPS exome sequencing data[edit]
- Data used:
- Libraries were constructed with the 1-adaptor protocol.
- DF6/Foreskin: HL022, two lanes per line, captured with probe set #1-7;
- CV-iPS/CV-fibroblast:
- HL020, two lanes per line, captured with probe set #8-9;
- HL022, three lanes for CV-iPS, captured with probe set #1-7;
- Read mapping and variant calling.
- Reads that contain potential H1/H2 capturing arms are identified and removed by mapping to a database that contains H1/H2 with 20bp flanking sequences.
- The remaining reads were mapped, down-sampled and fed to Samtools.
- This is the current mapping script: variantCallerBowtieSam.pl.
- Potential mutations were identified by comparing two pileup files ( pileup2variantsPair.pl);
- To be considered as a candidate mutation, I required that no single read contains the second allele in the reference sample.
- Results:
- 4 candidates of single nucleotide changes (SNCs) found in CV-iPS:CV-iPS_vs_fibro_set8-9_HL020;
- 5 candidates of SNCs found in DF6-9-9:DF6_Foreskin_HL022;
- Nine pairs of PCR primers were designed for these variants. However, ZNF708-K259R will be excluded in the first validation experiment because the flanking sequence has many highly similar homologs on the same chromosome.
PrimerID | LP | PrimerID | RP | Amplicon |
TRIM25-N534K-LP | GTGGCACCAGCAGAAAATAC | TRIM25-N534K-RP | TCCCCAGAGGTTCACATACT | >chr17:52324085+52324480 396bp |
SDR16C5-D139Y-LP | GTGAGCCACCTGGAGTATTT | SDR16C5-D139Y-RP | AAAGAAGTCGGCGATGTTTC | >chr8:57386991+57387395 405bp |
NTRK3-L585R-LP | ACAATGCCTAGAGCTTCCAA | NTRK3-L585R-RP | CTGCAGCAAAATGGAGTGTT | >chr15:86323500+86323903 404bp |
DAPL1-P18P-LP | GTCTCCTGCAGACATCTACC | DAPL1-P18P-RP | CAGAGAAGCTTCCGTCTGTC | >chr2:159359887+159360285 399bp |
ZZZ3-K214R-LP | CTTACCCTCCACTTTTGCAC | ZZZ3-K214R-RP | ACGACTCAGGTATTGTATGTC | >chr1:77816893+77817200 308bp |
PPP1R2-P97R-LP | CAGTATCCCAAGTGCAGGTA | PPP1R2-P97R-RP | CCCTTGTTTTTGTGGCTGAA | >chr3:196732652+196733047 396bp |
ITCH-T556A-LP | ACCCATGGAAGCAAGAAGAA | ITCH-T556A-RP | CAAAAGCGGGTCCTAAGCTA | >chr20:32522599+32523040 442bp |
NEK5-G23E-LP | TGGTTGCTGTTTGGACAATG | NEK5-G23E-RP | GCTGGGAGGAAAGTTTTAGC | >chr13:51599342+51599754 413bp |