Dinh/NOTES/2010-8-22: Difference between revisions
Jump to navigation
Jump to search
>Dinh mNo edit summary |
>Dinh mNo edit summary |
||
Line 67: | Line 67: | ||
| AmpF6.3NH2||/5AmMC6/CAGATGTTATCGAGGTCCGAC||5' Amino modifier C6 | | AmpF6.3NH2||/5AmMC6/CAGATGTTATCGAGGTCCGAC||5' Amino modifier C6 | ||
|- | |- | ||
| AmpR6.3NH2||/5AmMC6/ | | AmpR6.3NH2||/5AmMC6/GGAACGATGAGCCTCCAAC||5' Amino modifier C6 | ||
|- | |- | ||
| PE_t_N2, Y-adapter for MmeI ligation-top ||ACACTCTTTCCCTACACGACGCTCTTCCGATCTN*N||3'-Phosphorothioate bond | | PE_t_N2, Y-adapter for MmeI ligation-top ||ACACTCTTTCCCTACACGACGCTCTTCCGATCTN*N||3'-Phosphorothioate bond |
Latest revision as of 00:48, 12 November 2010
BSPP Capture and N2 library construction of John Hopkins Tumor Samples[edit]
Materials[edit]
Reagents and Kits | Source | Cat# |
EZ DNA Methylation Gold Kit | Zymo Research | D5005 |
10x Ampligase buffer | Epicentre | A1905B |
Ampligase | Epicentre | A3210K |
dNTP | New England Biolab | N0447L |
Stoffel fragment | Applied Biosystems | N808-0038 |
ExoI | Epicentre | X40520K |
ExoIII | Epicentre | EX4425K |
2xPhusion HF Master Mix | New England Biolab | F-531L |
MmeI | New England Biolab | R0637L |
Quick Ligation Kit | New England Biolab | M2200S |
SYBR GreenI nucleic acid gel stain | Invitrogen | S7585 |
Agencourt AMPure XP | Beckman Coulter | A63880 |
100% Ethanol | ||
QIAQuick PCR Purification Kit | Qiagen | 28106 |
E-Gel Size Select 2% | Invitrogen | G6610-02 |
Materials | Source | Cat# |
Low Tube Strips, CLR | BioRad | TLS0801 |
Microseal 'B' Film | BioRad | MSB1001 |
Barrier Tips, or low retention pipette tips | Neptune | BT200, BT10E, BT1000, BT20 |
Mineral Oil | Sigma | M5904-500ml |
6% TBE Gel 1.0mmx10well | Invitrogen | EC6265BOX |
10x TBE buffer for PAGE | National Diagnostics | EC-860 |
SYBR Gold nucleic acid gel stain | Invitrogen | S11494 |
Primers | Sequence | Modifications |
AmpF6.3NH2 | /5AmMC6/CAGATGTTATCGAGGTCCGAC | 5' Amino modifier C6 |
AmpR6.3NH2 | /5AmMC6/GGAACGATGAGCCTCCAAC | 5' Amino modifier C6 |
PE_t_N2, Y-adapter for MmeI ligation-top | ACACTCTTTCCCTACACGACGCTCTTCCGATCTN*N | 3'-Phosphorothioate bond |
PE_b_A, Y-adapter for MmeI ligation-bottom | /5Phos/AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG | 5'-Phosphorylation |
PCR_Fs | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC | None |
PCR_R.N2Ind1 | CAAGCAGAAGACGGCATACGAGATCGTGATCTCGGCATTCCTGCTGAACCGCTCTT | None |
PCR_R.N2Ind2 | CAAGCAGAAGACGGCATACGAGATACATCGCTCGGCATTCCTGCTGAACCGCTCTT | None |
PCR_R.N2Ind3 | CAAGCAGAAGACGGCATACGAGATGCCTAACTCGGCATTCCTGCTGAACCGCTCTT | None |
PCR_R.N2Ind4 | CAAGCAGAAGACGGCATACGAGATTGGTCACTCGGCATTCCTGCTGAACCGCTCTT | None |
Bisulfite Conversion[edit]
Perform bisulfite conversion according to instructions given in EZ Methylation Gold Kit.
Sample ID | Volume Used(ul) | Conc(ng/ul) | Volume obtained(ul) | Conc(ng/ul) | Yield |
499T | 4 | 250 | 8.5 | 91.5 | 0.78 |
499N | 5 | 195 | 8.5 | 67.9 | 0.59 |
536T | 4 | 250 | 8.5 | 76.2 | 0.65 |
536N | 4 | 250 | 8.5 | 105.4 | 0.9 |
614T | 4 | 250 | 8.5 | 94.8 | 0.81 |
614N | 4 | 250 | 8.5 | 81.4 | 0.69 |
Jurkat gDNA | 10 | 249 | 8.5 | 212.5 | 0.73 |
Capture[edit]
Set up capture reaction in low profile strip tubes (or PCR tubes/plates). Spin down the reaction mix and add 1-2 droplets of mineral oil with P200. Use Microseal film to cover the tubes.
Probe/Target Ratio | 100 | |
Probes size | 220000 | |
Template | 300 | ng |
Human gDNA MW | 1.82E+012 | g/mole (3E9bpx607.4D/bp+157.9D) |
Human gDNA | 1.65E-019 | moles |
Probes | 1.65E-017 | moles |
Probes MW | 6.88E+9 | g/mole (220000x103bpx303.7D/bp+79D) |
Amount probes required | 113 | ng |
Concentration probes 1 | 27 | ng/ul |
Vol | 4.20 | ul |
Concentration probes 2 | 23 | ng/ul |
Vol | 4.93 | ul |
Reaction Mix
Sample ID | Conc. (ng/ul) | Vol(ul) | Probes(ul) | 10xAmpligase Buffer (ul) | H2O | Total |
Sarven, 499T (biscvt) | 91.5 | 3.28 | 4.2 | 1 | 1.53 | 10 |
Sarven, 499N (biscvt) | 67.9 | 4.42 | 4.2 | 1 | 0.39 | 10 |
Sarven, Jurkat (biscvt) | 212.5 | 1.41 | 4.2 | 1 | 3.39 | 10 |
Dinh, 536T (biscvt) | 76.2 | 3.94 | 4.9 | 1 | 0.16 | 10 |
Dinh, 536N (biscvt) | 105.4 | 2.85 | 4.9 | 1 | 1.25 | 10 |
Dinh, Jurkat (biscvt) | 212.5 | 1.41 | 4.9 | 1 | 2.69 | 10 |
Program
95c 30sec -> cool down to 58C at 0.02C/sec -> 58C 20h -> add 2ul SLN mix(2U/ul AmpliTaq Stoffel fragment; 0.5U/ul AmpLigase; 50uM dNTP) -> 58C 20h-> 94C 2min -> add 2ul Exo I/III mix-> 37C 1h -> 94C 2min -> 4C hold.
Adding 2ul SLN mix after >20 h of 58C incubation: Leave tubes in thermocycler and just remove Microseal film cover to add SLN mix. Use P10, low retention tips and make sure to reach the bottom of the tube before dispensing. Dispense slowly, then slowly pull out the pipette tip before releasing hold on dispenser. Ensure that all reagents were pumped out. Cut new Microseal films to cover the tubes.
Adding 2ul ExoI/III mix after 3-4 h of 58C incubation: Perform same steps as adding SLN.
SLN Mix | 1x | 16x | Final Conc |
H2O | 0.55 | 8.8 | |
dNTP(1mM) | 0.05 | 0.8 | 50uM |
10xAmpligase Buffer | 0.1 | 1.6 | 1x |
AmpLigase | 0.1 | 1.6 | 0.5U/ul |
Stoffel | 0.2 | 3.2 | 2U/ul |
TOTAL | 1 | 16 |
For ExoI/III mix, add equal volumes of Exo I and Exo III.
PCR Amplification[edit]
3 + 1 NTC = 4
Reagent | Vol (1x) | Vol (8x) |
Template (*) | 10 | |
2x PhusionHF MM | 50 | 400 |
AmpF6.3NH2(10uM) | 2 | 16 |
AmpR6.3NH2(10uM) | 2 | 16 |
50x SYBR Green | 0.4 | 3.2 |
Rnase Free H2O | 35.6 | 286 |
TOTAL | 100 |
File:Capture rt-pcr JH- tumor-normal 499 and 536.PNG File:ZhangLab 2 2010-08-24 JH-tumor samples capture amp.png Expected capture amplicon size: 300bp Purify with 0.9x AMPure beads, elute with 40ul EB
Mme I digestion[edit]
1 units per 1ug phiX 174 DNA 1 phiX = 5 sites/5389bp 1 amplicon = 2 sites/300bp 7.2 units MmeI to digest 1ug capure PCR amplicons => 2.16 units to digest 300ng.
VOL REAGENT Conc Final 30.6 ul DNA + H2O ~300ng 4.0 ul NEBuffer 4 10x 1x 2.4 ul MmeI 2 units/ul 4.8 units (add double amount of required MmeI) 3.0 ul SAM 1mM 75uM -------------------------------------------- 40.0 ul TOTAL
Incubate at 37C for 1 hr. Purify with 1 Qiaquick column each, elute with 30ul EB. Run 1 ul each on 6% TBE gel
File:ZhangLab 2 2010-08-25 JH-tumor 499 536 MmeI digest.png Expected digest size: 300-43-45=212bp.
Quantification with low mass ladder
' | Signal Intensity | Volume Loaded | Calculated amount DNA(ng) |
0.1x low mass ladder | 8966.52 | 3 | 0.75 |
0.1x low mass ladder | 15987.17 | 6 | 1.5 |
5T partially digested | 5545.29 | 1 | 0.38 |
5T fully digested | 2309.56 | 1 | bad |
5N partially digested | 2578.99 | 1 | 0.07 |
5N fully digested | 974.66 | 1 | bad |
4T partially digested | 5612.13 | 1 | 0.39 |
4T fully digested | 4521.19 | 1 | 0.28 |
4N partially digested | 912.56 | 1 | bad |
536T -> 80% of partially digested band, 0.38ng/1ul*0.8*20 = ~6ng 536N -> 80% of partially digested band, 0.07ng/1ul*0.8*20 = ~1ng 499T -> 0.28*20 = ~6ng 499N -> est. = to 536N based on gel = ~1ng
N2 Adapter Ligation[edit]
Adaptors preparation:
20ul PE_N2_adaptor (100uM) 20ul PE_b_A (100uM) 10ul Stoffel buffer (10x) 50ul H2O ---------------------------- 100 ul TOTAL (20uM adaptors)
Program
94C 2min -> 0.2C/sec to 20C -> 4C hold
Adapters to ligated product ratio: 20:1
Est length of digested products: 212bp (after MmeI) MW digested products = (212bp*607.4 D/bp +157.9 D) = 128.927kD = 128,927 g/mole For 100 ng digested product = 100ng / 128,927g/mole = 7.76E-4 nmole * 20:1 = 0.02 nmole adapters required. Adapters (ul) = 0.02nmoles/ (20xE3nmoles/L * 1E-6L/ul) = 0.02nmoles/ (20E-3 nmoles/ul) = 0.77 ul -----> 0.77 ul of 20uM adapters per 100ng digested products. -----> 15.4 ul of 1uM adapters per 100ng digested products. use 1 ul of 1uM adapters per 6 ng digested products. use 0.4 ul of 0.5uM adapters per 1 ng digested products.
SampleID DNA(ul) Adapters(ul) QuickLigase(ul) 2xQuickLigase Buffer(ul) 499T 20ul (~6ng) 1 (1uM) 1 22 499N 20ul (~1ng) 0.4 (0.5uM) 1 21.4 536T 20ul (~6ng) 1 (1uM) 1 22 536N 20ul (~1ng) 0.4 (0.5uM) 1 21.4 Incubate at RT fo 15 min. Purify with 0.7x AMPure beads. Elute with 40ul EB.
Amplification[edit]
1x Reagents 10.0ul adapter ligased DNA 2.0ul PCR_F(10uM) 2.0ul PCR_R.N2IndX(10uM) [X=1,2,3,4] 0.4ul SYBR Green 50x 35.6ul H2O 50.0ul Phusion HF, 2xMM -------------------------------- 100 ul each x 3 per sample
Program
98C - 30s, (98C - 10s, 62C - 20s, 70C - 30s)x10/12, 72C - 2min. File:Ligated product rt-pcr JH- tumor-normal 499 and 536.PNG File:Ligated product rt-pcr JH- tumor-normal 499 and 536 -2.PNG Purify with 2 Qiaquick columns for each sample (~145ul reaction mix + 600ul PB per column)
Yield: 536T (56.5ng/ul), 499T (61.9ng/ul), 536N (12.7ng/ul), 499N (13.3ng/ul)
File:ZhangLab 2 2010-08-25 JH-tumor 499 536 Ligated products.png Expected ligated product size: 212+36+36=284bp. Expected amplified ligated product size: 212+64+60=336bp.
Size selection[edit]
Pool 254 ng of each sample into one tube --> 20ul (536N), 19.1ul (499N), 4.10ul(499T), 4.50ul(536T). Load sample into 2 lanes, use 25bp ladder ( should use low mass ladder instead to see 200-400bp range clearer ). Run E-Gel on DC mode (13 min). Remove sample when it reaches bottom well once.
File:ZhangLab 2 2010-08-25 JH-tumor 499 536 ss.png
Name on Tube: Library ID: DD-BSPP-JH.499,536-Aug25 DD-BSPP220K1-JH,499T.499N.536T.536N-Aug25-N2barcoded
Discussion[edit]
- Total RT-PCR cycles: 25-30 for entire protocol.
- Notes on MmeI use says excess MmeI blocks cleavage and advises stoichiometric concentrations be used for optimal cleavage.
- ~1ng MmeI digestion product is enough for ligation.