Noi/NOTES/2011-9-13: Difference between revisions
Jump to navigation
Jump to search
>Noi |
>Noi No edit summary |
||
Line 8: | Line 8: | ||
** 4 clones with poly T (TTTTTTT -> 7T) | ** 4 clones with poly T (TTTTTTT -> 7T) | ||
** 6 clones with random sequences (NNNNNNN -> 7N) | ** 6 clones with random sequences (NNNNNNN -> 7N) | ||
2011_09_14<br> | |||
Sample NP-NA-U-09 which showed TTT'''C'''TTT sequences was re-sequenced again. This time, the peak still showed the same pattern as C peak looked very clean. However Dinh and I though that it's unlikely that the random primer (NU) will have these sequence. We still need to validate this by running in Illumina sequencing as Dr. Zhang suggested. | |||
[[File:NP-NA-U-09-repeated.png| 600px]]<br> |
Revision as of 21:58, 14 September 2011
Sanger sequencing results of the amplicons amplified by randomly tagging primers with and without USER
- Continued from 2011_09_07: [[1]]
- 10 clones from the reaction with USER --> if there was no AmpFNU.Sol primer left over after USER digestion, we should observe every clone contains poly T sequences (TTTTTTT -> 7T) by reading with reverse primer, Syb_RP7.
- 8 clones showed very clear poly T sequences (7T). One clone (NP-NA-U-01) showed only 6T and another clone (NP-NA-U-09) showed TTTCTTT instead of TTTTTTT. For the first one, I think that it should be the error of primer synthesis since the surrounded sequences were corrected (GAGAGTGTTTTTTGTGTAGA). For the second one, I am not sure if it derived from the AmpFNU.Sol primer or the artifact of sequencing since the DNA chromatogram showed a very clear C peak. However, based on the failure cause of the this sample, it said that there was a spectral pull-up that might be caused by too much DNA in the reaction. For me, I believed that it should derive from the AmpAU.Sol primer as the reason of spectral pull-up that T pulled up G, C then A.
File:NP-NA-U-01.png
File:NP-NA-U-09.png
- 10 clones of positive control with no USER in the reaction --> we expected to see the mix of polyT (TTTTTTT -> 7T) and random sequences (NNNNNNN -> 7N)
- 4 clones with poly T (TTTTTTT -> 7T)
- 6 clones with random sequences (NNNNNNN -> 7N)
2011_09_14
Sample NP-NA-U-09 which showed TTTCTTT sequences was re-sequenced again. This time, the peak still showed the same pattern as C peak looked very clean. However Dinh and I though that it's unlikely that the random primer (NU) will have these sequence. We still need to validate this by running in Illumina sequencing as Dr. Zhang suggested.
File:NP-NA-U-09-repeated.png