Rui:DNAseq analysis on Hiseq120313: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>RuiLiu
(Created page with "==Hiseq_120313== ===Sample preparation=== [http://genome-tech.ucsd.edu/LabNotes/index.php/Rui_Liu#3.8.12_sample_for_Hiseq] ===Flow cell=== * s1-2: RL_B2_23s_Mar8.2012 * s5-6...")
 
>RuiLiu
Line 30: Line 30:
* following analysis
* following analysis
  [http://genome-tech.ucsd.edu/LabNotes/index.php/Kun:LabNotes/GenomeSeq/2012-4-10]
  [http://genome-tech.ucsd.edu/LabNotes/index.php/Kun:LabNotes/GenomeSeq/2012-4-10]
===Validation===
* multiple bands / unknown sequence in PCR results -> confirm primers on gDNA
* negative SNCs -> positive aliquot PCR
{| {{table}} border=1
| align="center" style="background:#f0f0f0;"|'''PCR-ID'''
| align="center" style="background:#f0f0f0;"|'''Gene'''
| align="center" style="background:#f0f0f0;"|'''Cat.'''
| align="center" style="background:#f0f0f0;"|'''chr'''
| align="center" style="background:#f0f0f0;"|'''pos'''
| align="center" style="background:#f0f0f0;"|'''refBase'''
| align="center" style="background:#f0f0f0;"|'''B2B3(GT)'''
| align="center" style="background:#f0f0f0;"|'''Pf'''
| align="center" style="background:#f0f0f0;"|'''Pr'''
| align="center" style="background:#f0f0f0;"|'''PCR'''
| align="center" style="background:#f0f0f0;"|''''''
|-
| SNC1||GLT25D2 (glycosyltransferase 25 domain containing 2)||exon||1||183907978||G||G=7/T=3||  CAGGGAGCCTTCATAGCTCA||  ACCTGAGTGACACGGAGACC||189bp||>chr1:183907885+183908073
|-
| ||||||||||||||||||||
|-
| QC good||Fib||P30||B2||B3||B2_MDA||B3_MDA||||||||
|-
| PCR||1 band||1 band||||||||||||||||
|-
| seq. ID||RL01_R||RL02||RL03||RL04||RL05||RL06||||||||
|-
| seq. length||350||160||160||160||160||70||||||||
|-
| blast||183907925 183908073||183907925 183908071||183907932 183908074||183907932 183908074||183907930 183908071||183907997 183908070||||||||
|-
| identity||100%||100%||100%||100%||100%||100%||||||||
|-
| SNC||G||G||G||G||G (T? C?)||N/A||||||||
|-
| aliquot||||||B2_Indx80,B2_Indx93,B3_Indx93||||||||||||||
|}

Revision as of 08:18, 27 April 2012

Hiseq_120313

Sample preparation

[1]

Flow cell

  • s1-2: RL_B2_23s_Mar8.2012
  • s5-6: RL_B3_24s_Mar8.2012
  • s7-8: RL_Fib-Bulk_Mar8.2012

Mapping

  • fastq
Genome-miner: /media/SeqStore2/120315_HiSeq/Genome
Triton: /projects/zhang-lab/seqStore/120313_HiSeq/Genome
  • prepare to submit jobs in triton
info file: File:B2 Indx73.info.txt
job file: File:B2 Indx73.job.txt
  1. An unique name for each library/index
  2. Excel or plain text for info/job files, tab-delimited plain text
  3. upload to triton (attn: space/line problems in nano format)
  4. tr "/r" "/n" < info.txt > info (convert to unix format)
  5. sed "s/73/xx/g" < 73.info > xx.info (convert to other index)
  6. qsub xx.job
  7. qstat | grep rul (check running status)
  8. qdel xxxx (kill job)
  9. triton contact info: Jim Hayes <jhayes@sdsc.edu> [2]
  • following analysis
[3]


Validation

  • multiple bands / unknown sequence in PCR results -> confirm primers on gDNA
  • negative SNCs -> positive aliquot PCR
PCR-ID Gene Cat. chr pos refBase B2B3(GT) Pf Pr PCR '
SNC1 GLT25D2 (glycosyltransferase 25 domain containing 2) exon 1 183907978 G G=7/T=3 CAGGGAGCCTTCATAGCTCA ACCTGAGTGACACGGAGACC 189bp >chr1:183907885+183908073
QC good Fib P30 B2 B3 B2_MDA B3_MDA
PCR 1 band 1 band
seq. ID RL01_R RL02 RL03 RL04 RL05 RL06
seq. length 350 160 160 160 160 70
blast 183907925 183908073 183907925 183908071 183907932 183908074 183907932 183908074 183907930 183908071 183907997 183908070
identity 100% 100% 100% 100% 100% 100%
SNC G G G G G (T? C?) N/A
aliquot B2_Indx80,B2_Indx93,B3_Indx93