Rui:DNAseq analysis on Hiseq120313: Difference between revisions
Jump to navigation
Jump to search
>RuiLiu (Created page with "==Hiseq_120313== ===Sample preparation=== [http://genome-tech.ucsd.edu/LabNotes/index.php/Rui_Liu#3.8.12_sample_for_Hiseq] ===Flow cell=== * s1-2: RL_B2_23s_Mar8.2012 * s5-6...") |
>RuiLiu m (→Mapping) |
||
Line 30: | Line 30: | ||
* following analysis | * following analysis | ||
[http://genome-tech.ucsd.edu/LabNotes/index.php/Kun:LabNotes/GenomeSeq/2012-4-10] | [http://genome-tech.ucsd.edu/LabNotes/index.php/Kun:LabNotes/GenomeSeq/2012-4-10] | ||
===Validation=== | |||
* multiple bands / unknown sequence in PCR results -> confirm primers on gDNA | |||
* negative SNCs -> positive aliquot PCR | |||
{| {{table}} border=1 | |||
| align="center" style="background:#f0f0f0;"|'''PCR-ID''' | |||
| align="center" style="background:#f0f0f0;"|'''Gene''' | |||
| align="center" style="background:#f0f0f0;"|'''Cat.''' | |||
| align="center" style="background:#f0f0f0;"|'''chr''' | |||
| align="center" style="background:#f0f0f0;"|'''pos''' | |||
| align="center" style="background:#f0f0f0;"|'''refBase''' | |||
| align="center" style="background:#f0f0f0;"|'''B2B3(GT)''' | |||
| align="center" style="background:#f0f0f0;"|'''Pf''' | |||
| align="center" style="background:#f0f0f0;"|'''Pr''' | |||
| align="center" style="background:#f0f0f0;"|'''PCR''' | |||
| align="center" style="background:#f0f0f0;"|'''''' | |||
|- | |||
| SNC1||GLT25D2 (glycosyltransferase 25 domain containing 2)||exon||1||183907978||G||G=7/T=3|| CAGGGAGCCTTCATAGCTCA|| ACCTGAGTGACACGGAGACC||189bp||>chr1:183907885+183908073 | |||
|- | |||
| |||||||||||||||||||| | |||
|- | |||
| QC good||Fib||P30||B2||B3||B2_MDA||B3_MDA|||||||| | |||
|- | |||
| PCR||1 band||1 band|||||||||||||||| | |||
|- | |||
| seq. ID||RL01_R||RL02||RL03||RL04||RL05||RL06|||||||| | |||
|- | |||
| seq. length||350||160||160||160||160||70|||||||| | |||
|- | |||
| blast||183907925 183908073||183907925 183908071||183907932 183908074||183907932 183908074||183907930 183908071||183907997 183908070|||||||| | |||
|- | |||
| identity||100%||100%||100%||100%||100%||100%|||||||| | |||
|- | |||
| SNC||G||G||G||G||G (T? C?)||N/A|||||||| | |||
|- | |||
| aliquot||||||B2_Indx80,B2_Indx93,B3_Indx93|||||||||||||| | |||
|} |
Revision as of 08:18, 27 April 2012
Hiseq_120313
Sample preparation
Flow cell
- s1-2: RL_B2_23s_Mar8.2012
- s5-6: RL_B3_24s_Mar8.2012
- s7-8: RL_Fib-Bulk_Mar8.2012
Mapping
- fastq
Genome-miner: /media/SeqStore2/120315_HiSeq/Genome Triton: /projects/zhang-lab/seqStore/120313_HiSeq/Genome
- prepare to submit jobs in triton
info file: File:B2 Indx73.info.txt job file: File:B2 Indx73.job.txt
- An unique name for each library/index
- Excel or plain text for info/job files, tab-delimited plain text
- upload to triton (attn: space/line problems in nano format)
- tr "/r" "/n" < info.txt > info (convert to unix format)
- sed "s/73/xx/g" < 73.info > xx.info (convert to other index)
- qsub xx.job
- qstat | grep rul (check running status)
- qdel xxxx (kill job)
- triton contact info: Jim Hayes <jhayes@sdsc.edu> [2]
- following analysis
[3]
Validation
- multiple bands / unknown sequence in PCR results -> confirm primers on gDNA
- negative SNCs -> positive aliquot PCR
PCR-ID | Gene | Cat. | chr | pos | refBase | B2B3(GT) | Pf | Pr | PCR | ' |
SNC1 | GLT25D2 (glycosyltransferase 25 domain containing 2) | exon | 1 | 183907978 | G | G=7/T=3 | CAGGGAGCCTTCATAGCTCA | ACCTGAGTGACACGGAGACC | 189bp | >chr1:183907885+183908073 |
QC good | Fib | P30 | B2 | B3 | B2_MDA | B3_MDA | ||||
PCR | 1 band | 1 band | ||||||||
seq. ID | RL01_R | RL02 | RL03 | RL04 | RL05 | RL06 | ||||
seq. length | 350 | 160 | 160 | 160 | 160 | 70 | ||||
blast | 183907925 183908073 | 183907925 183908071 | 183907932 183908074 | 183907932 183908074 | 183907930 183908071 | 183907997 183908070 | ||||
identity | 100% | 100% | 100% | 100% | 100% | 100% | ||||
SNC | G | G | G | G | G (T? C?) | N/A | ||||
aliquot | B2_Indx80,B2_Indx93,B3_Indx93 |