Rui:DNAseq analysis on Hiseq120313: Difference between revisions
Jump to navigation
Jump to search
>RuiLiu m (→Mapping) |
>RuiLiu m (→Validation) |
||
Line 68: | Line 68: | ||
|- | |- | ||
| aliquot||||||B2_Indx80,B2_Indx93,B3_Indx93|||||||||||||| | | aliquot||||||B2_Indx80,B2_Indx93,B3_Indx93|||||||||||||| | ||
|} | |||
{| {{table}} | |||
| align="center" style="background:#f0f0f0;"|'''PCR-ID''' | |||
| align="center" style="background:#f0f0f0;"|'''Gene''' | |||
| align="center" style="background:#f0f0f0;"|'''Cat.''' | |||
| align="center" style="background:#f0f0f0;"|'''chr''' | |||
| align="center" style="background:#f0f0f0;"|'''pos''' | |||
| align="center" style="background:#f0f0f0;"|'''refBase''' | |||
| align="center" style="background:#f0f0f0;"|'''B2B3(GT)''' | |||
| align="center" style="background:#f0f0f0;"|'''Primers''' | |||
| align="center" style="background:#f0f0f0;"|'''PCR''' | |||
|- | |||
| SNC2||FLNB (actin binding protein 278)||exon||3||58104657||C||C=6/G=3|| TTTGGTACCCAAAGGTAAACTGA||191 | |||
|- | |||
| |||||||||||||| CAACCCATCTGCTCTCCATT||>chr3:58104557+58104747 | |||
|- | |||
| failed, repeat||Fib||P30||B2||B3||B2_MDA||B3_MDA|||| | |||
|- | |||
| PCR|||||||||||||||| | |||
|- | |||
| seq. ID||RL09||RL10_R||RL11_R||RL12||RL13||RL14|||| | |||
|- | |||
| seq. length||141||330||141||170||||70|||| | |||
|- | |||
| blast||183907930 183908070||58104610 58104747||58104607 58104747||183907950 183908060||||183907997 183908061|||| | |||
|- | |||
| identity||98%||100%||100%||94%|||||||| | |||
|- | |||
| SNC||SNC1? T?||C||C||SNC1? T?||no match||SNC1? N/A|||| | |||
|- | |||
| aliquot||||||||||||||B2_Indx80,B2_Indx82,B3_Indx92|| | |||
|} | |} |
Revision as of 08:44, 27 April 2012
Hiseq_120313
Sample preparation
Flow cell
- s1-2: RL_B2_23s_Mar8.2012
- s5-6: RL_B3_24s_Mar8.2012
- s7-8: RL_Fib-Bulk_Mar8.2012
Mapping
- fastq
Genome-miner: /media/SeqStore2/120315_HiSeq/Genome Triton: /projects/zhang-lab/seqStore/120313_HiSeq/Genome
- prepare to submit jobs in triton
info file: File:B2 Indx73.info.txt job file: File:B2 Indx73.job.txt
- An unique name for each library/index
- Excel or plain text for info/job files, tab-delimited plain text
- upload to triton (attn: space/line problems in nano format)
- tr "/r" "/n" < info.txt > info (convert to unix format)
- sed "s/73/xx/g" < 73.info > xx.info (convert to other index)
- qsub xx.job
- qstat | grep rul (check running status)
- qdel xxxx (kill job)
- triton contact info: Jim Hayes <jhayes@sdsc.edu> [2]
- following analysis
[3]
Validation
- multiple bands / unknown sequence in PCR results -> confirm primers on gDNA
- negative SNCs -> positive aliquot PCR
PCR-ID | Gene | Cat. | chr | pos | refBase | B2B3(GT) | Pf | Pr | PCR | ' |
SNC1 | GLT25D2 (glycosyltransferase 25 domain containing 2) | exon | 1 | 183907978 | G | G=7/T=3 | CAGGGAGCCTTCATAGCTCA | ACCTGAGTGACACGGAGACC | 189bp | >chr1:183907885+183908073 |
QC good | Fib | P30 | B2 | B3 | B2_MDA | B3_MDA | ||||
PCR | 1 band | 1 band | ||||||||
seq. ID | RL01_R | RL02 | RL03 | RL04 | RL05 | RL06 | ||||
seq. length | 350 | 160 | 160 | 160 | 160 | 70 | ||||
blast | 183907925 183908073 | 183907925 183908071 | 183907932 183908074 | 183907932 183908074 | 183907930 183908071 | 183907997 183908070 | ||||
identity | 100% | 100% | 100% | 100% | 100% | 100% | ||||
SNC | G | G | G | G | G (T? C?) | N/A | ||||
aliquot | B2_Indx80,B2_Indx93,B3_Indx93 |
PCR-ID | Gene | Cat. | chr | pos | refBase | B2B3(GT) | Primers | PCR |
SNC2 | FLNB (actin binding protein 278) | exon | 3 | 58104657 | C | C=6/G=3 | TTTGGTACCCAAAGGTAAACTGA | 191 |
CAACCCATCTGCTCTCCATT | >chr3:58104557+58104747 | |||||||
failed, repeat | Fib | P30 | B2 | B3 | B2_MDA | B3_MDA | ||
PCR | ||||||||
seq. ID | RL09 | RL10_R | RL11_R | RL12 | RL13 | RL14 | ||
seq. length | 141 | 330 | 141 | 170 | 70 | |||
blast | 183907930 183908070 | 58104610 58104747 | 58104607 58104747 | 183907950 183908060 | 183907997 183908061 | |||
identity | 98% | 100% | 100% | 94% | ||||
SNC | SNC1? T? | C | C | SNC1? T? | no match | SNC1? N/A | ||
aliquot | B2_Indx80,B2_Indx82,B3_Indx92 |