Rui:DNAseq analysis on Hiseq120313: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>RuiLiu
>RuiLiu
Line 113: Line 113:
| align="center" style="background:#f0f0f0;"|'''PCR'''
| align="center" style="background:#f0f0f0;"|'''PCR'''
|-
|-
| SNC3||PPP1R9A (This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.)||exon||7||94918006||G||A=3/G=6||  AGTGTGCAGCAGGTTTCTCA||223
| SNC3||PPP1R9A ||exon||7||94918006||G||A=3/G=6||  AGTGTGCAGCAGGTTTCTCA||223
|-
|-
| ||||||||||||||  CCTCTCAGATATGCAGAATGCTC||>chr7:94917911+94918133
| ||||||||||||||  CCTCTCAGATATGCAGAATGCTC||>chr7:94917911+94918133

Revision as of 09:09, 27 April 2012

Hiseq_120313

Sample preparation

[1]

Flow cell

  • s1-2: RL_B2_23s_Mar8.2012
  • s5-6: RL_B3_24s_Mar8.2012
  • s7-8: RL_Fib-Bulk_Mar8.2012

Mapping

  • fastq
Genome-miner: /media/SeqStore2/120315_HiSeq/Genome
Triton: /projects/zhang-lab/seqStore/120313_HiSeq/Genome
  • prepare to submit jobs in triton
info file: File:B2 Indx73.info.txt
job file: File:B2 Indx73.job.txt
  1. An unique name for each library/index
  2. Excel or plain text for info/job files, tab-delimited plain text
  3. upload to triton (attn: space/line problems in nano format)
  4. tr "/r" "/n" < info.txt > info (convert to unix format)
  5. sed "s/73/xx/g" < 73.info > xx.info (convert to other index)
  6. qsub xx.job
  7. qstat | grep rul (check running status)
  8. qdel xxxx (kill job)
  9. triton contact info: Jim Hayes <jhayes@sdsc.edu> [2]
  • following analysis
[3]


Validation

  • multiple bands / unknown sequence in PCR results -> confirm primers on gDNA
  • negative SNCs -> positive aliquot PCR
PCR-ID Gene Cat. chr pos refBase B2B3(GT) Pf Pr PCR '
SNC1 GLT25D2 (glycosyltransferase 25 domain containing 2) exon 1 183907978 G G=7/T=3 CAGGGAGCCTTCATAGCTCA ACCTGAGTGACACGGAGACC 189bp >chr1:183907885+183908073
QC good Fib P30 B2 B3 B2_MDA B3_MDA
PCR 1 band 1 band
seq. ID RL01_R RL02 RL03 RL04 RL05 RL06
seq. length 350 160 160 160 160 70
blast 183907925 183908073 183907925 183908071 183907932 183908074 183907932 183908074 183907930 183908071 183907997 183908070
identity 100% 100% 100% 100% 100% 100%
SNC G G G G G (T? C?) N/A
aliquot B2_Indx80,B2_Indx93,B3_Indx93
PCR-ID Gene Cat. chr pos refBase B2B3(GT) Primers PCR
SNC2 FLNB (actin binding protein 278) exon 3 58104657 C C=6/G=3 TTTGGTACCCAAAGGTAAACTGA 191
CAACCCATCTGCTCTCCATT >chr3:58104557+58104747
failed, repeat Fib P30 B2 B3 B2_MDA B3_MDA
PCR
seq. ID RL09 RL10_R RL11_R RL12 RL13 RL14
seq. length 141 330 141 170 70
blast 183907930 183908070 58104610 58104747 58104607 58104747 183907950 183908060 183907997 183908061
identity 98% 100% 100% 94%
SNC SNC1? T? C C SNC1? T? no match SNC1? N/A
aliquot B2_Indx80,B2_Indx82,B3_Indx92
PCR-ID Gene Cat. chr pos refBase B2B3(GT) Primers PCR
SNC3 PPP1R9A exon 7 94918006 G A=3/G=6 AGTGTGCAGCAGGTTTCTCA 223
CCTCTCAGATATGCAGAATGCTC >chr7:94917911+94918133
QC good Fib P30 B2 B3 B2_MDA B3_MDA
PCR
seq. ID RL17 RL18 RL19 RL20 RL21 RL22
seq. length 184 270 846, chimeric 1K, chimeric 198 1K
blast 94917950 94918133 94917950 94918132 94917950 94918133 94917951 94918133 94917949 94918133
identity 100% 100%
SNC G G G G G chr1
aliquot all B3 B3_Indx82,B3_Indx95,B3_Indx96