Blue:RNAseq Primer List: Difference between revisions
Jump to navigation
Jump to search
>B1lake (Created page with " ==totoRNA primer sequence== * The 5' adaptors list {| {{table}} border=1 | align="center" style="background:#f0f0f0;"|'''Tube ID''' | align="center" style="background:#f...") |
>B1lake No edit summary |
||
Line 1: | Line 1: | ||
==Adaptor Structure== | |||
[http://genome-tech.ucsd.edu/LabNotes/index.php/Rui:Toto-TSO_RNAseq_protocol Rui's totoRNAseq Page] | |||
Revision as of 16:04, 7 July 2013
Adaptor Structure
totoRNA primer sequence
- The 5' adaptors list
Tube ID | Primer full name | Primer full sequence | PE_F-N10 | Barcode | TSO |
TSO.r04 | iso_B_TSO_N10 | iso-dCiso-dGiso-dCACACTCTTTCCCTACACGACGNNNUNNNNUNNNrGrGrG | /5Me-isodC//iisodG//iMe-isodC/ACACTCTTTCCCTACACGACGNNN/ideoxyU/NNNN/ideoxyU/NNN | \ | rGrGrG |
PB_PCR.F | PB_PCR.F | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG |